Incidental Mutation 'R5446:Olfr1257'
ID 429062
Institutional Source Beutler Lab
Gene Symbol Olfr1257
Ensembl Gene ENSMUSG00000049057
Gene Name olfactory receptor 1257
Synonyms MOR232-1, GA_x6K02T2Q125-51319458-51320387
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89878437-89883026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89881549 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 241 (H241L)
Ref Sequence ENSEMBL: ENSMUSP00000107144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060795] [ENSMUST00000111519]
AlphaFold Q8VGP0
Predicted Effect probably damaging
Transcript: ENSMUST00000060795
AA Change: H241L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056439
Gene: ENSMUSG00000049057
AA Change: H241L

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.6e-31 PFAM
Pfam:7tm_4 137 278 8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111519
AA Change: H241L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107144
Gene: ENSMUSG00000049057
AA Change: H241L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 3.9e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Olfr1257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Olfr1257 APN 2 89881662 missense probably benign 0.02
IGL01641:Olfr1257 APN 2 89881608 missense probably benign 0.01
IGL01668:Olfr1257 APN 2 89881099 missense probably benign 0.01
IGL01901:Olfr1257 APN 2 89881482 missense probably damaging 1.00
IGL02401:Olfr1257 APN 2 89881453 missense probably damaging 1.00
IGL02472:Olfr1257 APN 2 89881411 missense probably benign 0.44
IGL02631:Olfr1257 APN 2 89881255 missense possibly damaging 0.95
PIT4354001:Olfr1257 UTSW 2 89881508 missense probably benign 0.04
R0552:Olfr1257 UTSW 2 89880891 nonsense probably null
R0616:Olfr1257 UTSW 2 89881591 missense probably benign 0.07
R0943:Olfr1257 UTSW 2 89880961 missense probably benign 0.11
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1314:Olfr1257 UTSW 2 89880877 missense probably benign 0.35
R1641:Olfr1257 UTSW 2 89881401 missense probably benign 0.07
R1763:Olfr1257 UTSW 2 89881129 missense probably damaging 0.99
R1836:Olfr1257 UTSW 2 89881285 missense probably damaging 1.00
R2125:Olfr1257 UTSW 2 89881638 missense probably benign
R4322:Olfr1257 UTSW 2 89881734 missense probably benign 0.07
R4897:Olfr1257 UTSW 2 89881132 missense probably benign 0.39
R5456:Olfr1257 UTSW 2 89881258 missense probably damaging 0.97
R6415:Olfr1257 UTSW 2 89880862 missense probably damaging 1.00
R6905:Olfr1257 UTSW 2 89881708 missense probably benign 0.05
R7170:Olfr1257 UTSW 2 89880841 missense probably benign 0.12
R7170:Olfr1257 UTSW 2 89881053 missense possibly damaging 0.70
R7411:Olfr1257 UTSW 2 89881261 missense probably damaging 0.98
R8171:Olfr1257 UTSW 2 89881065 missense probably benign 0.05
R8490:Olfr1257 UTSW 2 89881167 missense probably damaging 1.00
R9176:Olfr1257 UTSW 2 89881171 missense probably benign 0.05
R9204:Olfr1257 UTSW 2 89881138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTGGCCCTAACATCATAG -3'
(R):5'- TGCTACCCAATTTCTTAATGGCATC -3'

Sequencing Primer
(F):5'- GTGTGATCTTAATCCTTTGCTCAAC -3'
(R):5'- TTAATGGCATCTTTCATCTGAGC -3'
Posted On 2016-09-06