Incidental Mutation 'R5446:Paip2b'
ID 429070
Institutional Source Beutler Lab
Gene Symbol Paip2b
Ensembl Gene ENSMUSG00000045896
Gene Name poly(A) binding protein interacting protein 2B
Synonyms
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 83805401-83831741 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83814862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 13 (I13V)
Ref Sequence ENSEMBL: ENSMUSP00000050404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058383]
AlphaFold Q91W45
Predicted Effect probably benign
Transcript: ENSMUST00000058383
AA Change: I13V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000050404
Gene: ENSMUSG00000045896
AA Change: I13V

DomainStartEndE-ValueType
Pfam:PAM2 118 135 5.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145593
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Most mRNAs, except for histones, contain a 3-prime poly(A) tail. Poly(A)-binding protein (PABP; see MIM 604679) enhances translation by circularizing mRNA through its interaction with the translation initiation factor EIF4G1 (MIM 600495) and the poly(A) tail. Various PABP-binding proteins regulate PABP activity, including PAIP1 (MIM 605184), a translational stimulator, and PAIP2A (MIM 605604) and PAIP2B, translational inhibitors (Derry et al., 2006 [PubMed 17381337]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal reproductive system physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Paip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Paip2b UTSW 6 83808841 missense probably damaging 1.00
R0635:Paip2b UTSW 6 83809909 missense possibly damaging 0.79
R5752:Paip2b UTSW 6 83831270 critical splice donor site probably null
R5994:Paip2b UTSW 6 83808885 missense probably damaging 0.99
R6102:Paip2b UTSW 6 83808846 missense possibly damaging 0.94
R6185:Paip2b UTSW 6 83809970 missense probably benign 0.01
R7342:Paip2b UTSW 6 83814826 missense probably damaging 0.97
R8819:Paip2b UTSW 6 83814756 missense probably damaging 1.00
R8820:Paip2b UTSW 6 83814756 missense probably damaging 1.00
R9634:Paip2b UTSW 6 83810041 missense probably damaging 1.00
Z1088:Paip2b UTSW 6 83808882 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGGATAGTGATTGTCTTCTACC -3'
(R):5'- GCTAACAGTTGTGTTTGTGTAAAGTAA -3'

Sequencing Primer
(F):5'- GATAGTGATTGTCTTCTACCTTTGC -3'
(R):5'- ATCCTGGGGAAGCATTTCAC -3'
Posted On 2016-09-06