Incidental Mutation 'R5446:Prkcg'
ID 429072
Institutional Source Beutler Lab
Gene Symbol Prkcg
Ensembl Gene ENSMUSG00000078816
Gene Name protein kinase C, gamma
Synonyms Prkcc, PKCgamma, Pkcc
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 3289179-3331099 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3330264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 675 (Y675F)
Ref Sequence ENSEMBL: ENSMUSP00000097874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092891] [ENSMUST00000100301] [ENSMUST00000172109]
AlphaFold P63318
Predicted Effect probably benign
Transcript: ENSMUST00000092891
SMART Domains Protein: ENSMUSP00000090567
Gene: ENSMUSG00000069806

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 196 4.4e-22 PFAM
Pfam:Claudin_2 18 197 2.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100301
AA Change: Y675F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816
AA Change: Y675F

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172109
AA Change: Y624F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816
AA Change: Y624F

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203454
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Depending upon genetic background, homozygous null mice show mild deficits in spatial learning and contextual conditioning. Genotype-dependent reductions in sensitivity to the effects of ethanol on righting reflex and hypothermia, in neuropathic pain after injury, and in anxiety are also evident. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Prkcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Prkcg APN 7 3319619 missense probably benign 0.27
IGL01551:Prkcg APN 7 3303826 unclassified probably benign
IGL02167:Prkcg APN 7 3322581 critical splice donor site probably null
IGL02434:Prkcg APN 7 3318890 missense probably benign
R0044:Prkcg UTSW 7 3315001 intron probably benign
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0413:Prkcg UTSW 7 3319579 missense probably benign 0.00
R0417:Prkcg UTSW 7 3304304 critical splice acceptor site probably null
R1113:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1170:Prkcg UTSW 7 3319661 missense probably damaging 0.97
R1308:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1634:Prkcg UTSW 7 3323470 missense probably damaging 1.00
R1978:Prkcg UTSW 7 3305346 missense probably damaging 1.00
R2016:Prkcg UTSW 7 3323550 missense probably damaging 0.98
R2209:Prkcg UTSW 7 3303581 unclassified probably benign
R3788:Prkcg UTSW 7 3313747 missense probably damaging 0.99
R4006:Prkcg UTSW 7 3327467 missense probably damaging 0.96
R4853:Prkcg UTSW 7 3318953 missense probably damaging 0.99
R4915:Prkcg UTSW 7 3330265 nonsense probably null
R4916:Prkcg UTSW 7 3330265 nonsense probably null
R4997:Prkcg UTSW 7 3322581 critical splice donor site probably null
R5646:Prkcg UTSW 7 3329081 missense probably damaging 0.97
R5677:Prkcg UTSW 7 3323458 missense probably damaging 1.00
R6913:Prkcg UTSW 7 3313819 missense probably benign 0.02
R7355:Prkcg UTSW 7 3323509 missense possibly damaging 0.94
R7371:Prkcg UTSW 7 3319553 missense probably benign 0.27
R7544:Prkcg UTSW 7 3310565 missense probably benign 0.00
R7649:Prkcg UTSW 7 3329964 missense probably benign 0.09
R7742:Prkcg UTSW 7 3329943 missense possibly damaging 0.84
R8009:Prkcg UTSW 7 3314192 missense probably benign
R8074:Prkcg UTSW 7 3323521 missense probably damaging 1.00
R8296:Prkcg UTSW 7 3329064 missense probably benign 0.37
R8344:Prkcg UTSW 7 3330170 missense probably damaging 1.00
R8887:Prkcg UTSW 7 3322341 missense possibly damaging 0.94
R9343:Prkcg UTSW 7 3310608 missense possibly damaging 0.55
R9426:Prkcg UTSW 7 3327459 missense probably damaging 1.00
R9530:Prkcg UTSW 7 3327449 missense possibly damaging 0.89
R9605:Prkcg UTSW 7 3310844 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCTCCTAAAGGGACGAACAG -3'
(R):5'- AACAGCGTCTAGAACTCGTTGG -3'

Sequencing Primer
(F):5'- ACCACGGGGATGTGCATAG -3'
(R):5'- CTAGAACTCGTTGGGGTGC -3'
Posted On 2016-09-06