Incidental Mutation 'R5446:Bcat2'
ID429074
Institutional Source Beutler Lab
Gene Symbol Bcat2
Ensembl Gene ENSMUSG00000030826
Gene Namebranched chain aminotransferase 2, mitochondrial
SynonymsEca40, Bcat-2
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5446 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45570153-45589711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45585145 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 110 (R110H)
Ref Sequence ENSEMBL: ENSMUSP00000147628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033098
AA Change: R150H

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: R150H

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117366
AA Change: R110H

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112933
Gene: ENSMUSG00000030826
AA Change: R110H

DomainStartEndE-ValueType
Pfam:Aminotran_4 79 335 2.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120296
AA Change: R110H

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112973
Gene: ENSMUSG00000030826
AA Change: R110H

DomainStartEndE-ValueType
Pfam:Aminotran_4 79 335 2.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120864
AA Change: R145H

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: R145H

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153219
AA Change: A159T
Predicted Effect possibly damaging
Transcript: ENSMUST00000209204
AA Change: R110H

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000209410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209569
Predicted Effect probably benign
Transcript: ENSMUST00000210811
Predicted Effect possibly damaging
Transcript: ENSMUST00000211173
AA Change: R110H

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Bcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Bcat2 APN 7 45588260 missense probably damaging 0.97
IGL02383:Bcat2 APN 7 45588007 missense probably damaging 1.00
IGL03157:Bcat2 APN 7 45575498 missense probably benign
IGL03226:Bcat2 APN 7 45588354 missense probably damaging 1.00
P0022:Bcat2 UTSW 7 45588345 missense probably damaging 1.00
R1251:Bcat2 UTSW 7 45575986 missense probably damaging 1.00
R1940:Bcat2 UTSW 7 45588368 missense possibly damaging 0.76
R6243:Bcat2 UTSW 7 45588267 missense probably benign 0.19
R6932:Bcat2 UTSW 7 45589321 missense probably damaging 0.98
R7336:Bcat2 UTSW 7 45575485 missense probably benign 0.00
R7434:Bcat2 UTSW 7 45576005 splice site probably null
R7645:Bcat2 UTSW 7 45587963 missense probably benign 0.04
R7732:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R7736:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R8140:Bcat2 UTSW 7 45588351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTTTGAGGGCTTGAAAG -3'
(R):5'- TTATACCCAGAGCTCTAGGCCC -3'

Sequencing Primer
(F):5'- AGCAGGTACGCCTCTTCC -3'
(R):5'- AGAGCTCTCCCTCAGACCAGG -3'
Posted On2016-09-06