Incidental Mutation 'R5446:Pwwp2b'
ID429076
Institutional Source Beutler Lab
Gene Symbol Pwwp2b
Ensembl Gene ENSMUSG00000060260
Gene NamePWWP domain containing 2B
SynonymsD930023J19Rik, Pwwp2, D7Ertd517e
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5446 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139248482-139269903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139255150 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 169 (I169N)
Ref Sequence ENSEMBL: ENSMUSP00000130888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093993] [ENSMUST00000172136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093993
AA Change: I169N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091529
Gene: ENSMUSG00000060260
AA Change: I169N

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
PDB:4LD6|A 485 506 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000172136
AA Change: I169N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130888
Gene: ENSMUSG00000060260
AA Change: I169N

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Pfam:PWWP 498 583 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Pwwp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Pwwp2b APN 7 139254855 nonsense probably null
IGL02209:Pwwp2b APN 7 139255105 missense probably damaging 1.00
IGL02938:Pwwp2b APN 7 139256143 missense probably damaging 1.00
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R1491:Pwwp2b UTSW 7 139255963 missense probably damaging 1.00
R1636:Pwwp2b UTSW 7 139254842 missense probably benign 0.00
R1672:Pwwp2b UTSW 7 139254831 missense probably benign
R1793:Pwwp2b UTSW 7 139256365 missense probably damaging 0.97
R2016:Pwwp2b UTSW 7 139256151 missense possibly damaging 0.91
R2159:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R2228:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2229:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2380:Pwwp2b UTSW 7 139255450 missense probably damaging 1.00
R3023:Pwwp2b UTSW 7 139256194 missense probably damaging 1.00
R3933:Pwwp2b UTSW 7 139256034 missense possibly damaging 0.66
R4440:Pwwp2b UTSW 7 139255639 missense probably benign 0.09
R4844:Pwwp2b UTSW 7 139255586 missense probably benign 0.09
R4873:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R4875:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R5022:Pwwp2b UTSW 7 139255578 missense possibly damaging 0.81
R5656:Pwwp2b UTSW 7 139255971 missense possibly damaging 0.93
R6465:Pwwp2b UTSW 7 139256035 missense probably benign 0.01
R6578:Pwwp2b UTSW 7 139256112 missense probably damaging 1.00
R6774:Pwwp2b UTSW 7 139255987 missense probably benign 0.13
R7218:Pwwp2b UTSW 7 139256133 missense probably damaging 1.00
R7316:Pwwp2b UTSW 7 139256224 missense probably benign 0.29
R7818:Pwwp2b UTSW 7 139255324 missense probably benign
X0017:Pwwp2b UTSW 7 139255806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACCCTGAGAAGGATCAGC -3'
(R):5'- ACAGCGCTGTCTTCTGGTTC -3'

Sequencing Primer
(F):5'- AGCCTCCCAAGACAGCTGTG -3'
(R):5'- CTGGTTCCTCTGGCTTTCGG -3'
Posted On2016-09-06