Incidental Mutation 'R5446:Ankrd52'
ID 429083
Institutional Source Beutler Lab
Gene Symbol Ankrd52
Ensembl Gene ENSMUSG00000014498
Gene Name ankyrin repeat domain 52
Synonyms G431002C21Rik
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128377115-128408704 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128388561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 736 (C736F)
Ref Sequence ENSEMBL: ENSMUSP00000014642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642]
AlphaFold Q8BTI7
Predicted Effect probably damaging
Transcript: ENSMUST00000014642
AA Change: C736F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498
AA Change: C736F

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198839
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Ankrd52
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Ankrd52 UTSW 10 128386452 missense probably benign 0.37
R0014:Ankrd52 UTSW 10 128386452 missense probably benign 0.37
R0139:Ankrd52 UTSW 10 128386138 missense probably benign 0.35
R0226:Ankrd52 UTSW 10 128389858 splice site probably null
R1355:Ankrd52 UTSW 10 128388696 missense possibly damaging 0.48
R1370:Ankrd52 UTSW 10 128388696 missense possibly damaging 0.48
R2190:Ankrd52 UTSW 10 128383618 missense probably benign 0.01
R2566:Ankrd52 UTSW 10 128389351 missense probably benign 0.39
R3884:Ankrd52 UTSW 10 128388955 missense probably damaging 0.96
R4624:Ankrd52 UTSW 10 128389259 missense probably damaging 1.00
R4706:Ankrd52 UTSW 10 128378161 missense probably benign
R4750:Ankrd52 UTSW 10 128378089 missense probably damaging 1.00
R4790:Ankrd52 UTSW 10 128380945 missense possibly damaging 0.62
R4965:Ankrd52 UTSW 10 128390507 missense probably benign 0.08
R5060:Ankrd52 UTSW 10 128389841 missense possibly damaging 0.87
R5798:Ankrd52 UTSW 10 128387610 missense probably benign 0.01
R5977:Ankrd52 UTSW 10 128382697 missense probably damaging 1.00
R5998:Ankrd52 UTSW 10 128383123 missense probably damaging 1.00
R6107:Ankrd52 UTSW 10 128387012 missense probably benign 0.19
R6478:Ankrd52 UTSW 10 128379331 splice site probably null
R6579:Ankrd52 UTSW 10 128387142 missense probably damaging 1.00
R6937:Ankrd52 UTSW 10 128387020 missense probably benign 0.42
R7078:Ankrd52 UTSW 10 128383657 missense probably benign 0.01
R7101:Ankrd52 UTSW 10 128382380 missense probably damaging 1.00
R7252:Ankrd52 UTSW 10 128381996 missense probably damaging 1.00
R7324:Ankrd52 UTSW 10 128386163 missense possibly damaging 0.74
R7505:Ankrd52 UTSW 10 128390055 missense probably damaging 0.99
R7979:Ankrd52 UTSW 10 128381988 missense probably damaging 1.00
R8178:Ankrd52 UTSW 10 128389301 missense probably damaging 1.00
R8520:Ankrd52 UTSW 10 128389490 missense probably damaging 1.00
R8985:Ankrd52 UTSW 10 128387109 missense probably damaging 1.00
R9068:Ankrd52 UTSW 10 128381981 missense probably damaging 1.00
R9717:Ankrd52 UTSW 10 128380588 missense probably benign 0.18
X0028:Ankrd52 UTSW 10 128381851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGCTATTCAGACTGTCAGGAG -3'
(R):5'- ACTAGTACCAGTGTAGGAGGCC -3'

Sequencing Primer
(F):5'- GCTATTCAGACTGTCAGGAGTATAGC -3'
(R):5'- AGTGCATGGGCGAGTATCC -3'
Posted On 2016-09-06