Incidental Mutation 'R5446:Jade2'
ID429084
Institutional Source Beutler Lab
Gene Symbol Jade2
Ensembl Gene ENSMUSG00000020387
Gene Namejade family PHD finger 2
SynonymsPhf15, 1200017K05Rik
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5446 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51813455-51857653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51816959 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 809 (V809A)
Ref Sequence ENSEMBL: ENSMUSP00000104719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020655] [ENSMUST00000109090] [ENSMUST00000109091]
Predicted Effect probably benign
Transcript: ENSMUST00000020655
AA Change: V809A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020655
Gene: ENSMUSG00000020387
AA Change: V809A

DomainStartEndE-ValueType
Pfam:EPL1 39 177 3.4e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109090
SMART Domains Protein: ENSMUSP00000104718
Gene: ENSMUSG00000020387

DomainStartEndE-ValueType
Pfam:EPL1 39 177 2e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109091
AA Change: V809A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104719
Gene: ENSMUSG00000020387
AA Change: V809A

DomainStartEndE-ValueType
Pfam:EPL1 2 176 9.6e-9 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Jade2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Jade2 APN 11 51825338 missense possibly damaging 0.95
IGL01935:Jade2 APN 11 51828384 missense possibly damaging 0.95
IGL02885:Jade2 APN 11 51831296 missense probably damaging 1.00
IGL02987:Jade2 APN 11 51830481 missense probably damaging 1.00
IGL02990:Jade2 APN 11 51831247 splice site probably benign
IGL03172:Jade2 APN 11 51825371 missense probably damaging 1.00
R0116:Jade2 UTSW 11 51831309 missense probably damaging 1.00
R1917:Jade2 UTSW 11 51818538 missense possibly damaging 0.95
R3410:Jade2 UTSW 11 51817223 missense probably benign
R3886:Jade2 UTSW 11 51830499 missense possibly damaging 0.79
R4846:Jade2 UTSW 11 51821148 missense probably benign
R4916:Jade2 UTSW 11 51817082 missense probably benign 0.01
R5420:Jade2 UTSW 11 51818607 missense probably benign 0.21
R5657:Jade2 UTSW 11 51816987 missense probably damaging 1.00
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6116:Jade2 UTSW 11 51835633 missense probably damaging 0.99
R7039:Jade2 UTSW 11 51828359 missense probably damaging 0.97
R7270:Jade2 UTSW 11 51817184 missense possibly damaging 0.89
R7702:Jade2 UTSW 11 51816917 missense probably damaging 1.00
R7797:Jade2 UTSW 11 51817299 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGTCCTAGGCCAGCACAG -3'
(R):5'- GAAGGTCAGTCGGAAATCTCC -3'

Sequencing Primer
(F):5'- CGGGGTGGAATTCAGAACTCTCTC -3'
(R):5'- AAATCTCCGGGTGCTAGATCC -3'
Posted On2016-09-06