Incidental Mutation 'R5446:Helz'
ID429085
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5446 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107632204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 737 (V737A)
Ref Sequence ENSEMBL: ENSMUSP00000102357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: V738A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: V738A

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: V737A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: V737A

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: V737A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: V737A

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133862
AA Change: V56A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: V56A

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143634
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R7982:Helz UTSW 11 107626630 missense possibly damaging 0.84
R8024:Helz UTSW 11 107686421 missense unknown
R8181:Helz UTSW 11 107672573 missense unknown
R8346:Helz UTSW 11 107672573 missense unknown
R8729:Helz UTSW 11 107637928 critical splice donor site probably null
R8807:Helz UTSW 11 107603009 missense probably damaging 1.00
R8821:Helz UTSW 11 107635093 missense probably damaging 0.99
R8891:Helz UTSW 11 107662016 missense probably damaging 0.99
R8909:Helz UTSW 11 107666008 missense possibly damaging 0.94
R8922:Helz UTSW 11 107649159 missense possibly damaging 0.90
R8926:Helz UTSW 11 107672683 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- TACTACAGCCTTAAACTCTGAGAGG -3'
(R):5'- AAGAGACCTGGCCAGATGTG -3'

Sequencing Primer
(F):5'- CCTTAAACTCTGAGAGGGTTGGAATG -3'
(R):5'- GAACCTGTCACTGGGAGAC -3'
Posted On2016-09-06