Incidental Mutation 'R5446:Vpreb1'
ID 429092
Institutional Source Beutler Lab
Gene Symbol Vpreb1
Ensembl Gene ENSMUSG00000059305
Gene Name pre-B lymphocyte gene 1
Synonyms Vpreb-1, CD179a
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 16868403-16870843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16868690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 112 (V112E)
Ref Sequence ENSEMBL: ENSMUSP00000074537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000075017] [ENSMUST00000100136] [ENSMUST00000232581] [ENSMUST00000232231] [ENSMUST00000231812] [ENSMUST00000232200] [ENSMUST00000232547] [ENSMUST00000232017] [ENSMUST00000232080]
AlphaFold P13372
Predicted Effect probably benign
Transcript: ENSMUST00000023465
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075017
AA Change: V112E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074537
Gene: ENSMUSG00000059305
AA Change: V112E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100136
SMART Domains Protein: ENSMUSP00000097713
Gene: ENSMUSG00000075370

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc1 126 200 2.17e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231576
Predicted Effect probably benign
Transcript: ENSMUST00000232581
Predicted Effect probably benign
Transcript: ENSMUST00000232231
Predicted Effect probably benign
Transcript: ENSMUST00000231812
Predicted Effect probably benign
Transcript: ENSMUST00000232200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232531
Predicted Effect probably benign
Transcript: ENSMUST00000232547
Predicted Effect probably benign
Transcript: ENSMUST00000232017
Predicted Effect probably benign
Transcript: ENSMUST00000232080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231704
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants have fewer cells with functional pre-B cell receptors. Double knockouts homozygous for null mutations at Vpreb1 and Vpreb2 show impaired B-cell development. Fewer B-cells are found in bone marrow, spleen and peritoneum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Vpreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Vpreb1 APN 16 16869087 missense probably benign 0.00
IGL02232:Vpreb1 APN 16 16868739 missense possibly damaging 0.95
R1824:Vpreb1 UTSW 16 16869071 splice site probably null
R1836:Vpreb1 UTSW 16 16869069 missense probably benign 0.17
R3625:Vpreb1 UTSW 16 16868804 missense probably benign 0.01
R5239:Vpreb1 UTSW 16 16868728 nonsense probably null
R6692:Vpreb1 UTSW 16 16868802 missense probably damaging 1.00
R6996:Vpreb1 UTSW 16 16868814 missense probably damaging 1.00
R7388:Vpreb1 UTSW 16 16868652 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCTCTGCAAAACCTCACG -3'
(R):5'- GCAACGACCATAACATTGGC -3'

Sequencing Primer
(F):5'- GCTCTGCAAAACCTCACGTTCTAC -3'
(R):5'- GGCATTTACAGCATTTACTGGTACC -3'
Posted On 2016-09-06