Incidental Mutation 'R5446:Vmn2r112'
ID 429095
Institutional Source Beutler Lab
Gene Symbol Vmn2r112
Ensembl Gene ENSMUSG00000094921
Gene Name vomeronasal 2, receptor 112
Synonyms EG628185
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 22601148-22619133 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22618250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 564 (Y564C)
Ref Sequence ENSEMBL: ENSMUSP00000094994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097381]
AlphaFold L7N221
Predicted Effect probably damaging
Transcript: ENSMUST00000097381
AA Change: Y564C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: Y564C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.8e-32 PFAM
Pfam:NCD3G 512 565 5.8e-21 PFAM
Pfam:7tm_3 598 833 6.5e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Vmn2r112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Vmn2r112 APN 17 22618936 missense probably benign 0.13
IGL01021:Vmn2r112 APN 17 22618904 missense probably damaging 1.00
IGL01122:Vmn2r112 APN 17 22603007 missense probably benign 0.00
IGL01360:Vmn2r112 APN 17 22618622 missense probably benign 0.03
IGL01536:Vmn2r112 APN 17 22605155 missense probably damaging 1.00
IGL02148:Vmn2r112 APN 17 22619032 missense probably damaging 1.00
IGL02465:Vmn2r112 APN 17 22614994 missense probably damaging 1.00
PIT4576001:Vmn2r112 UTSW 17 22614931 missense probably benign 0.00
R0278:Vmn2r112 UTSW 17 22603006 missense probably benign 0.44
R0328:Vmn2r112 UTSW 17 22605270 missense probably benign 0.01
R0583:Vmn2r112 UTSW 17 22618949 missense probably damaging 1.00
R0831:Vmn2r112 UTSW 17 22614999 missense probably damaging 0.99
R1080:Vmn2r112 UTSW 17 22618999 missense probably damaging 1.00
R1245:Vmn2r112 UTSW 17 22603247 missense probably benign 0.03
R1321:Vmn2r112 UTSW 17 22618519 nonsense probably null
R1381:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R1514:Vmn2r112 UTSW 17 22602844 missense probably benign 0.40
R1519:Vmn2r112 UTSW 17 22618903 missense possibly damaging 0.83
R1572:Vmn2r112 UTSW 17 22603144 missense possibly damaging 0.61
R1590:Vmn2r112 UTSW 17 22615008 critical splice donor site probably null
R1640:Vmn2r112 UTSW 17 22605116 missense probably benign 0.01
R2221:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2223:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2310:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2312:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2337:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2339:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2340:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2341:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2342:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2401:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2860:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2861:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2926:Vmn2r112 UTSW 17 22615003 missense possibly damaging 0.90
R3236:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3237:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3977:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3979:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R4168:Vmn2r112 UTSW 17 22603088 missense probably benign 0.01
R4256:Vmn2r112 UTSW 17 22618412 missense probably damaging 1.00
R4386:Vmn2r112 UTSW 17 22601322 missense probably benign 0.36
R4912:Vmn2r112 UTSW 17 22603382 missense probably damaging 0.99
R4947:Vmn2r112 UTSW 17 22602879 missense probably benign 0.02
R5870:Vmn2r112 UTSW 17 22619023 missense probably benign 0.00
R6351:Vmn2r112 UTSW 17 22601278 missense probably benign
R6384:Vmn2r112 UTSW 17 22605155 missense probably damaging 1.00
R6390:Vmn2r112 UTSW 17 22605249 missense probably benign 0.01
R6401:Vmn2r112 UTSW 17 22603551 nonsense probably null
R6405:Vmn2r112 UTSW 17 22618235 missense probably damaging 1.00
R6620:Vmn2r112 UTSW 17 22603101 missense probably benign 0.00
R6648:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R6649:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6653:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6654:Vmn2r112 UTSW 17 22603469 missense possibly damaging 0.89
R6700:Vmn2r112 UTSW 17 22603481 missense possibly damaging 0.53
R6993:Vmn2r112 UTSW 17 22603214 missense probably benign 0.01
R7052:Vmn2r112 UTSW 17 22602526 missense probably benign
R7454:Vmn2r112 UTSW 17 22603307 missense probably benign 0.00
R7763:Vmn2r112 UTSW 17 22603118 missense probably damaging 1.00
R8032:Vmn2r112 UTSW 17 22603394 missense probably benign 0.21
R8177:Vmn2r112 UTSW 17 22603613 missense possibly damaging 0.47
R8263:Vmn2r112 UTSW 17 22605159 missense probably damaging 1.00
R8395:Vmn2r112 UTSW 17 22618606 missense possibly damaging 0.94
R8492:Vmn2r112 UTSW 17 22602489 missense probably benign 0.03
R8889:Vmn2r112 UTSW 17 22618631 missense probably damaging 1.00
R8892:Vmn2r112 UTSW 17 22618631 missense probably damaging 1.00
R9246:Vmn2r112 UTSW 17 22605107 missense probably benign 0.21
R9269:Vmn2r112 UTSW 17 22601232 missense probably benign
R9273:Vmn2r112 UTSW 17 22618740 missense probably damaging 1.00
R9288:Vmn2r112 UTSW 17 22603342 missense probably damaging 1.00
R9352:Vmn2r112 UTSW 17 22603498 missense probably damaging 0.98
R9406:Vmn2r112 UTSW 17 22605242 nonsense probably null
R9432:Vmn2r112 UTSW 17 22602252 missense
R9728:Vmn2r112 UTSW 17 22605127 missense probably damaging 0.96
Z1088:Vmn2r112 UTSW 17 22605078 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTAACAGTGACTTTCAATGAATTCT -3'
(R):5'- GAGTCCTGTTATTGGCCTTAACA -3'

Sequencing Primer
(F):5'- CCCTGGTTAACCATATCAAAGTG -3'
(R):5'- CCTGTTATTGGCCTTAACAATTGGAG -3'
Posted On 2016-09-06