Incidental Mutation 'R5447:Mettl13'
ID429104
Institutional Source Beutler Lab
Gene Symbol Mettl13
Ensembl Gene ENSMUSG00000026694
Gene Namemethyltransferase like 13
Synonyms5630401D24Rik
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162532127-162548551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162535880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000135879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028017] [ENSMUST00000159316] [ENSMUST00000159817] [ENSMUST00000176220]
Predicted Effect probably benign
Transcript: ENSMUST00000028017
AA Change: V595A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028017
Gene: ENSMUSG00000026694
AA Change: V595A

DomainStartEndE-ValueType
Pfam:TPMT 13 172 1e-7 PFAM
Pfam:Ubie_methyltran 38 190 6.6e-7 PFAM
Pfam:Methyltransf_31 46 198 5.3e-13 PFAM
Pfam:Methyltransf_18 48 161 1.1e-10 PFAM
Pfam:Methyltransf_25 52 154 3.7e-9 PFAM
Pfam:Methyltransf_11 53 158 4.1e-16 PFAM
low complexity region 436 452 N/A INTRINSIC
Pfam:Spermine_synth 472 630 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159316
SMART Domains Protein: ENSMUSP00000135822
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Methyltransf_25 1 101 2.7e-10 PFAM
Pfam:Methyltransf_18 1 102 8e-11 PFAM
Pfam:Methyltransf_31 1 149 1.9e-12 PFAM
Pfam:Methyltransf_11 2 100 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159817
SMART Domains Protein: ENSMUSP00000124267
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:TPMT 13 144 4.6e-8 PFAM
Pfam:Methyltransf_31 46 195 3.5e-12 PFAM
Pfam:Methyltransf_18 48 160 5e-11 PFAM
Pfam:Methyltransf_25 52 154 1.1e-9 PFAM
Pfam:Methyltransf_11 53 158 6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176220
AA Change: V227A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135879
Gene: ENSMUSG00000026694
AA Change: V227A

DomainStartEndE-ValueType
Pfam:Spermine_synth 73 239 1.8e-8 PFAM
Pfam:Methyltransf_18 126 234 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176689
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Mettl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mettl13 APN 1 162535865 missense possibly damaging 0.74
IGL00589:Mettl13 APN 1 162542391 missense probably damaging 1.00
IGL01765:Mettl13 APN 1 162538953 missense probably benign
IGL02200:Mettl13 APN 1 162538823 intron probably benign
IGL02835:Mettl13 UTSW 1 162546016 missense probably damaging 0.97
R0055:Mettl13 UTSW 1 162546181 missense probably damaging 1.00
R0322:Mettl13 UTSW 1 162544176 splice site probably benign
R0390:Mettl13 UTSW 1 162538889 missense possibly damaging 0.51
R0423:Mettl13 UTSW 1 162544385 missense probably damaging 1.00
R0723:Mettl13 UTSW 1 162534430 missense probably damaging 1.00
R1472:Mettl13 UTSW 1 162537167 missense possibly damaging 0.95
R2429:Mettl13 UTSW 1 162546325 nonsense probably null
R3755:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R3756:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R4058:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4059:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4087:Mettl13 UTSW 1 162548202 missense possibly damaging 0.53
R4885:Mettl13 UTSW 1 162537268 missense probably damaging 0.99
R4974:Mettl13 UTSW 1 162537220 missense probably damaging 0.99
R5070:Mettl13 UTSW 1 162545899 missense possibly damaging 0.47
R5702:Mettl13 UTSW 1 162545980 missense probably benign 0.00
R6137:Mettl13 UTSW 1 162535886 missense probably benign 0.09
R6570:Mettl13 UTSW 1 162544286 missense probably damaging 0.99
R6754:Mettl13 UTSW 1 162548123 missense probably damaging 1.00
R7340:Mettl13 UTSW 1 162538978 missense probably benign 0.00
R7386:Mettl13 UTSW 1 162548154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGAGCCTCAATTCCTTGC -3'
(R):5'- TGTCTTCAGCAGGCAGAGTAC -3'

Sequencing Primer
(F):5'- CTTGCAGTCCTCTGAGATAGCAG -3'
(R):5'- GCAGAGTACTCACGTCGTCATC -3'
Posted On2016-09-06