Incidental Mutation 'R5447:Hoxd4'
ID429107
Institutional Source Beutler Lab
Gene Symbol Hoxd4
Ensembl Gene ENSMUSG00000101174
Gene Namehomeobox D4
SynonymsHox-4.2, Hox-5.1
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location74711929-74729123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74727343 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 22 (E22G)
Ref Sequence ENSEMBL: ENSMUSP00000051355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047904] [ENSMUST00000053932] [ENSMUST00000111980] [ENSMUST00000111983]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047904
AA Change: E22G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047949
Gene: ENSMUSG00000115956
AA Change: E22G

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053932
AA Change: E22G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642
AA Change: E22G

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 370 431 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083566
Predicted Effect possibly damaging
Transcript: ENSMUST00000111980
AA Change: E22G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107611
Gene: ENSMUSG00000101174
AA Change: E22G

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111983
SMART Domains Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144040
Meta Mutation Damage Score 0.2461 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in determining positional values in developing limb buds. Alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit homeotic transformations of the second cervical vertebrae and malformed neural arches of C1 to C3 and of the basioccipital bone. Mutants show variable penetrance and expressivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Hoxd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Hoxd4 APN 2 74728406 missense probably damaging 0.98
IGL03403:Hoxd4 APN 2 74728337 missense possibly damaging 0.93
R0153:Hoxd4 UTSW 2 74727457 missense probably damaging 0.96
R3424:Hoxd4 UTSW 2 74727313 missense probably damaging 1.00
R5715:Hoxd4 UTSW 2 74727364 missense probably damaging 1.00
R6197:Hoxd4 UTSW 2 74728463 missense possibly damaging 0.85
R6264:Hoxd4 UTSW 2 74727385 missense possibly damaging 0.53
R6310:Hoxd4 UTSW 2 74728390 missense possibly damaging 0.84
R6336:Hoxd4 UTSW 2 74727361 missense probably damaging 1.00
R6921:Hoxd4 UTSW 2 74728492 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATGGCCGCCCAACTTTATTC -3'
(R):5'- TCATCCAAGGGTAGACCACAGC -3'

Sequencing Primer
(F):5'- TTATTCAGTTGACAGCAAGTAGGAG -3'
(R):5'- ACCGTAATGACTTCCCGGG -3'
Posted On2016-09-06