Incidental Mutation 'R5447:Nfs1'
ID429115
Institutional Source Beutler Lab
Gene Symbol Nfs1
Ensembl Gene ENSMUSG00000027618
Gene Namenitrogen fixation gene 1 (S. cerevisiae)
Synonymsm-Nfs1
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156123639-156144186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156142136 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 107 (R107H)
Ref Sequence ENSEMBL: ENSMUSP00000105229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000088610] [ENSMUST00000109597] [ENSMUST00000109598] [ENSMUST00000109600] [ENSMUST00000119950] [ENSMUST00000184469]
Predicted Effect probably benign
Transcript: ENSMUST00000029147
AA Change: R107H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618
AA Change: R107H

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 424 6.2e-94 PFAM
Pfam:Beta_elim_lyase 94 344 7.8e-12 PFAM
Pfam:DegT_DnrJ_EryC1 100 250 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088610
SMART Domains Protein: ENSMUSP00000085981
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109597
SMART Domains Protein: ENSMUSP00000105226
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109598
SMART Domains Protein: ENSMUSP00000105227
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Romo1 13 79 1.34e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109600
AA Change: R107H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105229
Gene: ENSMUSG00000027618
AA Change: R107H

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 118 3.5e-12 PFAM
low complexity region 138 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119950
SMART Domains Protein: ENSMUSP00000113943
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125449
Predicted Effect probably benign
Transcript: ENSMUST00000184469
SMART Domains Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 81 2.3e-10 PFAM
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Nfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Nfs1 APN 2 156124271 missense probably damaging 1.00
IGL02944:Nfs1 APN 2 156127768 missense probably damaging 1.00
IGL03350:Nfs1 APN 2 156127740 missense probably benign 0.37
R0118:Nfs1 UTSW 2 156134524 missense probably damaging 1.00
R0374:Nfs1 UTSW 2 156132660 missense probably damaging 1.00
R1653:Nfs1 UTSW 2 156125336 missense probably damaging 1.00
R3787:Nfs1 UTSW 2 156128583 missense possibly damaging 0.53
R4614:Nfs1 UTSW 2 156144050 missense probably benign 0.04
R4782:Nfs1 UTSW 2 156134449 missense possibly damaging 0.94
R4799:Nfs1 UTSW 2 156134449 missense possibly damaging 0.94
R5053:Nfs1 UTSW 2 156126398 missense probably damaging 0.99
R5479:Nfs1 UTSW 2 156128502 missense probably damaging 1.00
R5992:Nfs1 UTSW 2 156134453 missense probably damaging 0.98
R7267:Nfs1 UTSW 2 156123783 missense probably benign 0.12
R7400:Nfs1 UTSW 2 156126323 missense probably damaging 1.00
R7886:Nfs1 UTSW 2 156142061 missense unknown
R7969:Nfs1 UTSW 2 156142061 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCATTGACCCGCGAAATG -3'
(R):5'- AGGTTGGAAATGCACTGAGC -3'

Sequencing Primer
(F):5'- AGTGTTAACCTTACGAGCACTGC -3'
(R):5'- GCACTGAGCAAGGTTGGC -3'
Posted On2016-09-06