Incidental Mutation 'R5447:Nfs1'
ID 429115
Institutional Source Beutler Lab
Gene Symbol Nfs1
Ensembl Gene ENSMUSG00000027618
Gene Name nitrogen fixation gene 1 (S. cerevisiae)
Synonyms m-Nfs1
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 156123639-156144186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 156142136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 107 (R107H)
Ref Sequence ENSEMBL: ENSMUSP00000105229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000088610] [ENSMUST00000109597] [ENSMUST00000109598] [ENSMUST00000109600] [ENSMUST00000119950] [ENSMUST00000184469]
AlphaFold Q9Z1J3
Predicted Effect probably benign
Transcript: ENSMUST00000029147
AA Change: R107H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618
AA Change: R107H

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 424 6.2e-94 PFAM
Pfam:Beta_elim_lyase 94 344 7.8e-12 PFAM
Pfam:DegT_DnrJ_EryC1 100 250 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088610
SMART Domains Protein: ENSMUSP00000085981
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109597
SMART Domains Protein: ENSMUSP00000105226
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109598
SMART Domains Protein: ENSMUSP00000105227
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Romo1 13 79 1.34e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109600
AA Change: R107H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105229
Gene: ENSMUSG00000027618
AA Change: R107H

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 118 3.5e-12 PFAM
low complexity region 138 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119950
SMART Domains Protein: ENSMUSP00000113943
Gene: ENSMUSG00000067847

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125449
Predicted Effect probably benign
Transcript: ENSMUST00000184469
SMART Domains Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 81 2.3e-10 PFAM
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,927,326 (GRCm38) I479V probably damaging Het
Adam30 A G 3: 98,161,343 (GRCm38) D164G probably benign Het
Adgrl3 T A 5: 81,465,341 (GRCm38) probably benign Het
Adrb1 T C 19: 56,723,087 (GRCm38) I239T probably benign Het
Albfm1 C A 5: 90,584,310 (GRCm38) A458E probably damaging Het
B4galnt3 T C 6: 120,215,057 (GRCm38) T572A probably benign Het
Baz2b T C 2: 59,913,988 (GRCm38) E1391G probably damaging Het
BC016579 A G 16: 45,648,889 (GRCm38) V72A probably benign Het
Btnl10 A T 11: 58,922,318 (GRCm38) I258F probably benign Het
Cdh5 A T 8: 104,129,362 (GRCm38) D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 (GRCm38) D1042G probably damaging Het
Clk2 G T 3: 89,167,191 (GRCm38) V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 (GRCm38) D15G possibly damaging Het
Dip2b C T 15: 100,211,986 (GRCm38) R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 (GRCm38) Y1836C probably damaging Het
Dysf T C 6: 84,195,263 (GRCm38) F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 (GRCm38) S7P unknown Het
Fam110a T C 2: 151,970,709 (GRCm38) E47G probably damaging Het
Gemin6 T G 17: 80,227,749 (GRCm38) V46G probably damaging Het
Helb T A 10: 120,102,901 (GRCm38) D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 (GRCm38) E22G probably damaging Het
Hsd17b8 A T 17: 34,026,912 (GRCm38) V202D probably damaging Het
Il1rl2 T G 1: 40,329,156 (GRCm38) I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 (GRCm38) T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 (GRCm38) A1283V probably benign Het
Mettl13 A G 1: 162,535,880 (GRCm38) V227A probably benign Het
Mmgt2 T A 11: 62,664,998 (GRCm38) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,912,510 (GRCm38) S175P probably damaging Het
Neu4 C T 1: 94,022,418 (GRCm38) T33M probably damaging Het
Nfxl1 C T 5: 72,529,169 (GRCm38) R563Q probably benign Het
Nid1 A G 13: 13,437,910 (GRCm38) D70G probably benign Het
Nup160 C A 2: 90,725,615 (GRCm38) Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 (GRCm38) C75* probably null Het
Or1ad8 G A 11: 51,007,343 (GRCm38) V124M possibly damaging Het
Or1e22 A G 11: 73,486,176 (GRCm38) V216A probably benign Het
Or52s6 A C 7: 103,442,940 (GRCm38) M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 (GRCm38) V422E probably damaging Het
Pear1 G A 3: 87,759,142 (GRCm38) R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 (GRCm38) M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 (GRCm38) V62A possibly damaging Het
Prol1 C T 5: 88,328,266 (GRCm38) P172S unknown Het
Proz A G 8: 13,072,578 (GRCm38) I231V probably benign Het
Ptch1 T G 13: 63,527,245 (GRCm38) M718L probably benign Het
Ptprs A G 17: 56,429,128 (GRCm38) C102R possibly damaging Het
Robo2 A T 16: 73,973,766 (GRCm38) Y490* probably null Het
Rptor G A 11: 119,843,713 (GRCm38) G514D probably damaging Het
Scara5 CG C 14: 65,759,662 (GRCm38) probably null Het
Skint6 T A 4: 113,105,909 (GRCm38) S442C probably benign Het
Snw1 T C 12: 87,455,715 (GRCm38) E303G probably benign Het
Sp110 C G 1: 85,589,118 (GRCm38) E219D probably damaging Het
Stam2 G A 2: 52,736,293 (GRCm38) probably benign Het
Stk10 C T 11: 32,604,166 (GRCm38) Q618* probably null Het
Tmc3 A T 7: 83,622,361 (GRCm38) E907V possibly damaging Het
Ttn T A 2: 76,899,107 (GRCm38) probably benign Het
Ttn A T 2: 76,811,243 (GRCm38) L5176Q possibly damaging Het
Vps39 T C 2: 120,352,932 (GRCm38) D19G probably benign Het
Zan T C 5: 137,472,191 (GRCm38) S229G probably damaging Het
Zfp141 A T 7: 42,475,559 (GRCm38) C496* probably null Het
Zgrf1 T C 3: 127,563,119 (GRCm38) S665P possibly damaging Het
Other mutations in Nfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Nfs1 APN 2 156,124,271 (GRCm38) missense probably damaging 1.00
IGL02944:Nfs1 APN 2 156,127,768 (GRCm38) missense probably damaging 1.00
IGL03350:Nfs1 APN 2 156,127,740 (GRCm38) missense probably benign 0.37
lantana UTSW 2 156,134,449 (GRCm38) missense possibly damaging 0.94
G1Funyon:Nfs1 UTSW 2 156,134,493 (GRCm38) nonsense probably null
R0118:Nfs1 UTSW 2 156,134,524 (GRCm38) missense probably damaging 1.00
R0374:Nfs1 UTSW 2 156,132,660 (GRCm38) missense probably damaging 1.00
R1653:Nfs1 UTSW 2 156,125,336 (GRCm38) missense probably damaging 1.00
R3787:Nfs1 UTSW 2 156,128,583 (GRCm38) missense possibly damaging 0.53
R4614:Nfs1 UTSW 2 156,144,050 (GRCm38) missense probably benign 0.04
R4782:Nfs1 UTSW 2 156,134,449 (GRCm38) missense possibly damaging 0.94
R4799:Nfs1 UTSW 2 156,134,449 (GRCm38) missense possibly damaging 0.94
R5053:Nfs1 UTSW 2 156,126,398 (GRCm38) missense probably damaging 0.99
R5479:Nfs1 UTSW 2 156,128,502 (GRCm38) missense probably damaging 1.00
R5992:Nfs1 UTSW 2 156,134,453 (GRCm38) missense probably damaging 0.98
R7267:Nfs1 UTSW 2 156,123,783 (GRCm38) missense probably benign 0.12
R7400:Nfs1 UTSW 2 156,126,323 (GRCm38) missense probably damaging 1.00
R7886:Nfs1 UTSW 2 156,142,061 (GRCm38) missense unknown
R8301:Nfs1 UTSW 2 156,134,493 (GRCm38) nonsense probably null
R8729:Nfs1 UTSW 2 156,123,807 (GRCm38) missense probably benign 0.20
R8905:Nfs1 UTSW 2 156,128,583 (GRCm38) missense probably damaging 0.96
R9099:Nfs1 UTSW 2 156,127,014 (GRCm38) missense probably damaging 1.00
R9417:Nfs1 UTSW 2 156,123,931 (GRCm38) nonsense probably null
R9661:Nfs1 UTSW 2 156,128,553 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCATTGACCCGCGAAATG -3'
(R):5'- AGGTTGGAAATGCACTGAGC -3'

Sequencing Primer
(F):5'- AGTGTTAACCTTACGAGCACTGC -3'
(R):5'- GCACTGAGCAAGGTTGGC -3'
Posted On 2016-09-06