Incidental Mutation 'R5447:Pear1'
ID429116
Institutional Source Beutler Lab
Gene Symbol Pear1
Ensembl Gene ENSMUSG00000028073
Gene Nameplatelet endothelial aggregation receptor 1
SynonymsJedi-1, 3110045G13Rik
MMRRC Submission 043012-MU
Accession Numbers

Ncbi RefSeq: NM_001032413.1, NM_001032414.1, NM_028460.2, NM_152799.2; MGI:1920432

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87747890-87824306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87759142 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 85 (R85C)
Ref Sequence ENSEMBL: ENSMUSP00000133749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172590] [ENSMUST00000172621] [ENSMUST00000173184] [ENSMUST00000173225] [ENSMUST00000173468] [ENSMUST00000174219] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759] [ENSMUST00000174776]
Predicted Effect probably damaging
Transcript: ENSMUST00000029714
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079083
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090981
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172590
AA Change: R6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133480
Gene: ENSMUSG00000028073
AA Change: R6C

DomainStartEndE-ValueType
Blast:EGF 23 50 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172621
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172631
Predicted Effect probably damaging
Transcript: ENSMUST00000173184
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134100
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 95 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173225
SMART Domains Protein: ENSMUSP00000134387
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173468
AA Change: R85C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133988
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 2.1e-16 PFAM
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF 184 215 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173747
Predicted Effect probably benign
Transcript: ENSMUST00000174219
SMART Domains Protein: ENSMUSP00000133565
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF 15 47 4.03e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174759
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174776
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133749
Gene: ENSMUSG00000028073
AA Change: R85C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 6.3e-17 PFAM
Blast:FU 97 120 1e-5 BLAST
Meta Mutation Damage Score 0.2433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PEAR1 is a platelet receptor that signals upon the formation of platelet-platelet contacts independent of platelet activation and secondary to platelet aggregation (Nanda et al., 2005 [PubMed 15851471]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent defects in hemostasis or thrombus formation. Although in vitro dextran sulfate-induced platelet aggregation is impaired, platelet aggregation initiated with physiological agonists is normal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Pear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Pear1 APN 3 87752116 missense possibly damaging 0.65
IGL01810:Pear1 APN 3 87752301 missense probably damaging 0.98
IGL02269:Pear1 APN 3 87756264 missense probably damaging 1.00
IGL02635:Pear1 APN 3 87750146 makesense probably null
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0090:Pear1 UTSW 3 87754342 missense possibly damaging 0.82
R0547:Pear1 UTSW 3 87788800 intron probably null
R1024:Pear1 UTSW 3 87760299 unclassified probably benign
R1612:Pear1 UTSW 3 87751853 critical splice donor site probably null
R1637:Pear1 UTSW 3 87756753 missense probably damaging 0.97
R1772:Pear1 UTSW 3 87754492 unclassified probably benign
R1888:Pear1 UTSW 3 87810575 splice site probably benign
R2129:Pear1 UTSW 3 87758359 nonsense probably null
R2255:Pear1 UTSW 3 87752186 missense probably damaging 1.00
R3551:Pear1 UTSW 3 87758132 missense probably benign
R3855:Pear1 UTSW 3 87751921 missense possibly damaging 0.94
R4021:Pear1 UTSW 3 87756222 missense possibly damaging 0.89
R4546:Pear1 UTSW 3 87754661 missense probably damaging 1.00
R5364:Pear1 UTSW 3 87758361 missense probably damaging 1.00
R5504:Pear1 UTSW 3 87752695 splice site probably benign
R6026:Pear1 UTSW 3 87756913 missense probably damaging 1.00
R6061:Pear1 UTSW 3 87755931 missense probably benign 0.02
R6155:Pear1 UTSW 3 87759568 missense probably damaging 0.97
R6175:Pear1 UTSW 3 87752133 missense possibly damaging 0.93
R6339:Pear1 UTSW 3 87752520 missense probably damaging 1.00
R6385:Pear1 UTSW 3 87754199 missense probably benign 0.00
R6715:Pear1 UTSW 3 87759117 missense probably damaging 1.00
R6929:Pear1 UTSW 3 87759565 nonsense probably null
R7088:Pear1 UTSW 3 87754638 missense possibly damaging 0.80
R7097:Pear1 UTSW 3 87751445 missense probably benign 0.00
R7229:Pear1 UTSW 3 87750289 missense probably benign 0.00
R7334:Pear1 UTSW 3 87750225 missense probably damaging 1.00
R7526:Pear1 UTSW 3 87752568 missense probably damaging 0.99
R7872:Pear1 UTSW 3 87752215 missense probably benign
R7955:Pear1 UTSW 3 87752215 missense probably benign
X0063:Pear1 UTSW 3 87754072 missense probably damaging 1.00
Z1177:Pear1 UTSW 3 87751340 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTACTGGCCAAAGGGGAACTG -3'
(R):5'- TTCACCTGTCTACAGTGGGTAC -3'

Sequencing Primer
(F):5'- CTGAAGGAGCAGACAGTAGCACC -3'
(R):5'- AGGTGTGTCTAGTTCATTGGACAC -3'
Posted On2016-09-06