Incidental Mutation 'R5447:Clk2'
ID429117
Institutional Source Beutler Lab
Gene Symbol Clk2
Ensembl Gene ENSMUSG00000068917
Gene NameCDC-like kinase 2
Synonyms
MMRRC Submission 043012-MU
Accession Numbers

Genbank: NM_007712, NM_001163432

Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89164795-89176921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89167191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 53 (V53F)
Ref Sequence ENSEMBL: ENSMUSP00000122202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090927] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000128318] [ENSMUST00000148265] [ENSMUST00000152205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090927
AA Change: V53F

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917
AA Change: V53F

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121212
AA Change: V53F

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917
AA Change: V53F

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121931
AA Change: V53F

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917
AA Change: V53F

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128318
AA Change: V53F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917
AA Change: V53F

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138822
Predicted Effect possibly damaging
Transcript: ENSMUST00000148265
AA Change: V53F

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122634
Gene: ENSMUSG00000068917
AA Change: V53F

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
Pfam:Pkinase 162 249 7.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152205
AA Change: V53F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122202
Gene: ENSMUSG00000068917
AA Change: V53F

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153255
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit decreased hepatic fatty acid oxidation and ketogenesis. [provided by MGI curators]
Allele List at MGI

 All alleles(12) : Targeted, other(1) Gene trapped(11)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Clk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Clk2 APN 3 89175422 missense probably damaging 0.99
IGL01152:Clk2 APN 3 89176511 missense probably damaging 0.99
IGL02342:Clk2 APN 3 89175691 missense probably benign 0.00
IGL02387:Clk2 APN 3 89176391 unclassified probably benign
IGL02553:Clk2 APN 3 89175713 missense probably damaging 1.00
IGL02861:Clk2 APN 3 89173399 missense probably damaging 0.99
3-1:Clk2 UTSW 3 89170348 missense probably damaging 0.98
R1511:Clk2 UTSW 3 89168703 missense probably damaging 1.00
R1892:Clk2 UTSW 3 89175195 missense possibly damaging 0.48
R3796:Clk2 UTSW 3 89175689 missense probably benign
R3844:Clk2 UTSW 3 89170403 missense probably benign 0.06
R4737:Clk2 UTSW 3 89168709 missense probably benign 0.44
R5138:Clk2 UTSW 3 89175499 unclassified probably benign
R5413:Clk2 UTSW 3 89173478 missense probably benign 0.22
R5538:Clk2 UTSW 3 89175655 missense probably damaging 0.99
R6128:Clk2 UTSW 3 89174224 missense probably damaging 1.00
R7346:Clk2 UTSW 3 89173545 critical splice donor site probably null
R7578:Clk2 UTSW 3 89176500 missense probably benign
R7762:Clk2 UTSW 3 89167191 missense probably benign 0.13
R7894:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
R7977:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
R8248:Clk2 UTSW 3 89173504 missense probably damaging 1.00
R8295:Clk2 UTSW 3 89173459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGCATTCCACGAGAACG -3'
(R):5'- ACAATGCCTGGTGGGTACAG -3'

Sequencing Primer
(F):5'- CATTCCACGAGAACGGTTATG -3'
(R):5'- GTCTCATTATGTAGACCAGGCTGAC -3'
Posted On2016-09-06