Incidental Mutation 'R5447:Adam30'
ID 429118
Institutional Source Beutler Lab
Gene Symbol Adam30
Ensembl Gene ENSMUSG00000043468
Gene Name a disintegrin and metallopeptidase domain 30
Synonyms 4933424D07Rik
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 98067950-98071485 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98068659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000060505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]
AlphaFold Q811Q3
Predicted Effect probably benign
Transcript: ENSMUST00000050342
AA Change: D164G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: D164G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 159 5.7e-20 PFAM
low complexity region 176 187 N/A INTRINSIC
Pfam:Reprolysin 202 393 1.1e-31 PFAM
DISIN 407 482 1.6e-32 SMART
ACR 483 625 1.84e-52 SMART
transmembrane domain 690 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198363
AA Change: D36G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: D36G

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:Reprolysin_5 72 259 2.6e-6 PFAM
Pfam:Reprolysin 74 265 2.1e-29 PFAM
Pfam:Reprolysin_3 101 220 1.1e-4 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,891,061 (GRCm39) I479V probably damaging Het
Adgrl3 T A 5: 81,613,188 (GRCm39) probably benign Het
Adrb1 T C 19: 56,711,519 (GRCm39) I239T probably benign Het
Albfm1 C A 5: 90,732,169 (GRCm39) A458E probably damaging Het
B4galnt3 T C 6: 120,192,018 (GRCm39) T572A probably benign Het
Baz2b T C 2: 59,744,332 (GRCm39) E1391G probably damaging Het
BC016579 A G 16: 45,469,252 (GRCm39) V72A probably benign Het
Btnl10 A T 11: 58,813,144 (GRCm39) I258F probably benign Het
Cdh5 A T 8: 104,855,994 (GRCm39) D309V probably damaging Het
Cdhr2 A G 13: 54,881,063 (GRCm39) D1042G probably damaging Het
Clk2 G T 3: 89,074,498 (GRCm39) V53F possibly damaging Het
Cyfip2 T C 11: 46,182,413 (GRCm39) D15G possibly damaging Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Dmbt1 A G 7: 130,721,240 (GRCm39) Y1836C probably damaging Het
Dysf T C 6: 84,172,245 (GRCm39) F1905L probably damaging Het
E130114P18Rik A G 4: 97,578,955 (GRCm39) S7P unknown Het
Fam110a T C 2: 151,812,629 (GRCm39) E47G probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Helb T A 10: 119,938,806 (GRCm39) D556V possibly damaging Het
Hoxd4 A G 2: 74,557,687 (GRCm39) E22G probably damaging Het
Hsd17b8 A T 17: 34,245,886 (GRCm39) V202D probably damaging Het
Il1rl2 T G 1: 40,368,316 (GRCm39) I162R probably damaging Het
Lhfpl5 A G 17: 28,795,071 (GRCm39) T33A probably damaging Het
Mapk8ip3 G A 17: 25,118,163 (GRCm39) A1283V probably benign Het
Mettl13 A G 1: 162,363,449 (GRCm39) V227A probably benign Het
Mmgt2 T A 11: 62,555,824 (GRCm39) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,754,430 (GRCm39) S175P probably damaging Het
Neu4 C T 1: 93,950,140 (GRCm39) T33M probably damaging Het
Nfs1 C T 2: 155,984,056 (GRCm39) R107H probably benign Het
Nfxl1 C T 5: 72,686,512 (GRCm39) R563Q probably benign Het
Nid1 A G 13: 13,612,495 (GRCm39) D70G probably benign Het
Nup160 C A 2: 90,555,959 (GRCm39) Q1220K possibly damaging Het
Or1ad8 G A 11: 50,898,170 (GRCm39) V124M possibly damaging Het
Or1e22 A G 11: 73,377,002 (GRCm39) V216A probably benign Het
Or52s6 A C 7: 103,092,147 (GRCm39) M61R probably damaging Het
Or5k8 A T 16: 58,644,846 (GRCm39) C75* probably null Het
Pdgfrb T A 18: 61,201,180 (GRCm39) V422E probably damaging Het
Pear1 G A 3: 87,666,449 (GRCm39) R85C probably damaging Het
Pkhd1 T A 1: 20,309,609 (GRCm39) M2780L probably benign Het
Ppp4r4 T C 12: 103,550,410 (GRCm39) V62A possibly damaging Het
Prol1 C T 5: 88,476,125 (GRCm39) P172S unknown Het
Proz A G 8: 13,122,578 (GRCm39) I231V probably benign Het
Ptch1 T G 13: 63,675,059 (GRCm39) M718L probably benign Het
Ptprs A G 17: 56,736,128 (GRCm39) C102R possibly damaging Het
Robo2 A T 16: 73,770,654 (GRCm39) Y490* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Skint6 T A 4: 112,963,106 (GRCm39) S442C probably benign Het
Snw1 T C 12: 87,502,485 (GRCm39) E303G probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Stk10 C T 11: 32,554,166 (GRCm39) Q618* probably null Het
Tmc3 A T 7: 83,271,569 (GRCm39) E907V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T A 2: 76,729,451 (GRCm39) probably benign Het
Vps39 T C 2: 120,183,413 (GRCm39) D19G probably benign Het
Zan T C 5: 137,470,453 (GRCm39) S229G probably damaging Het
Zfp141 A T 7: 42,124,983 (GRCm39) C496* probably null Het
Zgrf1 T C 3: 127,356,768 (GRCm39) S665P possibly damaging Het
Other mutations in Adam30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Adam30 APN 3 98,069,486 (GRCm39) missense probably benign 0.01
IGL01630:Adam30 APN 3 98,069,171 (GRCm39) missense possibly damaging 0.83
IGL01825:Adam30 APN 3 98,069,217 (GRCm39) missense probably damaging 0.96
IGL02033:Adam30 APN 3 98,068,787 (GRCm39) missense probably benign 0.13
IGL03157:Adam30 APN 3 98,069,612 (GRCm39) missense possibly damaging 0.85
IGL03330:Adam30 APN 3 98,069,772 (GRCm39) missense probably damaging 1.00
R0512:Adam30 UTSW 3 98,069,441 (GRCm39) missense probably damaging 1.00
R1082:Adam30 UTSW 3 98,069,606 (GRCm39) missense probably benign 0.30
R1173:Adam30 UTSW 3 98,070,222 (GRCm39) missense probably benign 0.07
R1463:Adam30 UTSW 3 98,069,841 (GRCm39) missense probably damaging 1.00
R1771:Adam30 UTSW 3 98,068,835 (GRCm39) missense possibly damaging 0.94
R1862:Adam30 UTSW 3 98,069,429 (GRCm39) nonsense probably null
R3442:Adam30 UTSW 3 98,069,886 (GRCm39) missense probably benign 0.35
R4125:Adam30 UTSW 3 98,068,679 (GRCm39) missense probably damaging 1.00
R4714:Adam30 UTSW 3 98,070,170 (GRCm39) missense probably damaging 1.00
R4816:Adam30 UTSW 3 98,070,061 (GRCm39) missense possibly damaging 0.68
R5958:Adam30 UTSW 3 98,069,280 (GRCm39) missense probably damaging 1.00
R6175:Adam30 UTSW 3 98,070,266 (GRCm39) missense probably damaging 1.00
R6220:Adam30 UTSW 3 98,068,625 (GRCm39) missense probably damaging 0.98
R6338:Adam30 UTSW 3 98,068,857 (GRCm39) missense probably damaging 1.00
R6365:Adam30 UTSW 3 98,068,350 (GRCm39) missense probably damaging 0.99
R6998:Adam30 UTSW 3 98,070,026 (GRCm39) missense probably benign 0.03
R7086:Adam30 UTSW 3 98,068,635 (GRCm39) missense probably damaging 1.00
R7290:Adam30 UTSW 3 98,070,257 (GRCm39) missense probably benign 0.00
R7340:Adam30 UTSW 3 98,069,637 (GRCm39) missense probably benign 0.14
R8181:Adam30 UTSW 3 98,070,291 (GRCm39) missense probably benign
R8725:Adam30 UTSW 3 98,070,348 (GRCm39) missense possibly damaging 0.96
R8727:Adam30 UTSW 3 98,070,348 (GRCm39) missense possibly damaging 0.96
R8913:Adam30 UTSW 3 98,068,580 (GRCm39) missense possibly damaging 0.68
R8977:Adam30 UTSW 3 98,069,378 (GRCm39) missense probably damaging 0.98
R9008:Adam30 UTSW 3 98,070,034 (GRCm39) nonsense probably null
R9126:Adam30 UTSW 3 98,068,307 (GRCm39) missense probably benign 0.00
R9181:Adam30 UTSW 3 98,070,194 (GRCm39) missense probably benign 0.05
R9274:Adam30 UTSW 3 98,069,267 (GRCm39) missense probably benign 0.06
R9338:Adam30 UTSW 3 98,070,129 (GRCm39) missense probably damaging 1.00
R9636:Adam30 UTSW 3 98,068,312 (GRCm39) missense probably benign 0.06
R9640:Adam30 UTSW 3 98,069,620 (GRCm39) missense probably damaging 1.00
R9651:Adam30 UTSW 3 98,069,936 (GRCm39) missense possibly damaging 0.92
Z1176:Adam30 UTSW 3 98,069,676 (GRCm39) missense possibly damaging 0.92
Z1177:Adam30 UTSW 3 98,068,295 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCACTCAAGAGGGCAG -3'
(R):5'- CCTAGACATATTGCCACGGG -3'

Sequencing Primer
(F):5'- CAGTCTGATAGAGGATTATCCGC -3'
(R):5'- GGGCAAACACGAATCTATCCAGG -3'
Posted On 2016-09-06