Mutagenetix > Incidental Mutation

Incidental Mutation 'R5447:Adam30'

429118

Institutional Source

Beutler Lab

Gene Symbol

Adam30

Ensembl Gene

ENSMUSG00000043468

Gene Name

a disintegrin and metallopeptidase domain 30

Synonyms

4933424D07Rik

MMRRC Submission

043012-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R5447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98160630-98164169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98161343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 164 (D164G)

Ref Sequence

ENSEMBL: ENSMUSP00000060505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]

AlphaFold

Q811Q3

Predicted Effect

probably benign
Transcript: ENSMUST00000050342
AA Change: D164G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: D164G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Pep_M12B_propep	36	159	5.7e-20	PFAM
low complexity region	176	187	N/A	INTRINSIC
Pfam:Reprolysin	202	393	1.1e-31	PFAM
DISIN	407	482	1.6e-32	SMART
ACR	483	625	1.84e-52	SMART
transmembrane domain	690	712	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198363
AA Change: D36G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: D36G

Domain	Start	End	E-Value	Type
low complexity region	48	59	N/A	INTRINSIC
Pfam:Reprolysin_5	72	259	2.6e-6	PFAM
Pfam:Reprolysin	74	265	2.1e-29	PFAM
Pfam:Reprolysin_3	101	220	1.1e-4	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	C	A	5: 90,584,310	A458E	probably damaging	Het
Abcb5	T	C	12: 118,927,326	I479V	probably damaging	Het
Adgrl3	T	A	5: 81,465,341		probably benign	Het
Adrb1	T	C	19: 56,723,087	I239T	probably benign	Het
B4galnt3	T	C	6: 120,215,057	T572A	probably benign	Het
Baz2b	T	C	2: 59,913,988	E1391G	probably damaging	Het
BC016579	A	G	16: 45,648,889	V72A	probably benign	Het
Btnl10	A	T	11: 58,922,318	I258F	probably benign	Het
Cdh5	A	T	8: 104,129,362	D309V	probably damaging	Het
Cdhr2	A	G	13: 54,733,250	D1042G	probably damaging	Het
Clk2	G	T	3: 89,167,191	V53F	possibly damaging	Het
Cyfip2	T	C	11: 46,291,586	D15G	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Dmbt1	A	G	7: 131,119,511	Y1836C	probably damaging	Het
Dysf	T	C	6: 84,195,263	F1905L	probably damaging	Het
E130114P18Rik	A	G	4: 97,690,718	S7P	unknown	Het
Fam110a	T	C	2: 151,970,709	E47G	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
H2-Ke6	A	T	17: 34,026,912	V202D	probably damaging	Het
Helb	T	A	10: 120,102,901	D556V	possibly damaging	Het
Hoxd4	A	G	2: 74,727,343	E22G	probably damaging	Het
Il1rl2	T	G	1: 40,329,156	I162R	probably damaging	Het
Lhfpl5	A	G	17: 28,576,097	T33A	probably damaging	Het
Mapk8ip3	G	A	17: 24,899,189	A1283V	probably benign	Het
Mettl13	A	G	1: 162,535,880	V227A	probably benign	Het
Mmgt2	T	A	11: 62,664,998	C57*	probably null	Het
Muc4	G	C	16: 32,753,919	R1265P	probably benign	Het
Mylk2	T	C	2: 152,912,510	S175P	probably damaging	Het
Neu4	C	T	1: 94,022,418	T33M	probably damaging	Het
Nfs1	C	T	2: 156,142,136	R107H	probably benign	Het
Nfxl1	C	T	5: 72,529,169	R563Q	probably benign	Het
Nid1	A	G	13: 13,437,910	D70G	probably benign	Het
Nup160	C	A	2: 90,725,615	Q1220K	possibly damaging	Het
Olfr175-ps1	A	T	16: 58,824,483	C75*	probably null	Het
Olfr381	A	G	11: 73,486,176	V216A	probably benign	Het
Olfr51	G	A	11: 51,007,343	V124M	possibly damaging	Het
Olfr605	A	C	7: 103,442,940	M61R	probably damaging	Het
Pdgfrb	T	A	18: 61,068,108	V422E	probably damaging	Het
Pear1	G	A	3: 87,759,142	R85C	probably damaging	Het
Pkhd1	T	A	1: 20,239,385	M2780L	probably benign	Het
Ppp4r4	T	C	12: 103,584,151	V62A	possibly damaging	Het
Prol1	C	T	5: 88,328,266	P172S	unknown	Het
Proz	A	G	8: 13,072,578	I231V	probably benign	Het
Ptch1	T	G	13: 63,527,245	M718L	probably benign	Het
Ptprs	A	G	17: 56,429,128	C102R	possibly damaging	Het
Robo2	A	T	16: 73,973,766	Y490*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Skint6	T	A	4: 113,105,909	S442C	probably benign	Het
Snw1	T	C	12: 87,455,715	E303G	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Stk10	C	T	11: 32,604,166	Q618*	probably null	Het
Tmc3	A	T	7: 83,622,361	E907V	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	T	A	2: 76,899,107		probably benign	Het
Vps39	T	C	2: 120,352,932	D19G	probably benign	Het
Zan	T	C	5: 137,472,191	S229G	probably damaging	Het
Zfp141	A	T	7: 42,475,559	C496*	probably null	Het
Zgrf1	T	C	3: 127,563,119	S665P	possibly damaging	Het

Other mutations in Adam30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Adam30	APN	3	98162170	missense	probably benign	0.01
IGL01630:Adam30	APN	3	98161855	missense	possibly damaging	0.83
IGL01825:Adam30	APN	3	98161901	missense	probably damaging	0.96
IGL02033:Adam30	APN	3	98161471	missense	probably benign	0.13
IGL03157:Adam30	APN	3	98162296	missense	possibly damaging	0.85
IGL03330:Adam30	APN	3	98162456	missense	probably damaging	1.00
R0512:Adam30	UTSW	3	98162125	missense	probably damaging	1.00
R1082:Adam30	UTSW	3	98162290	missense	probably benign	0.30
R1173:Adam30	UTSW	3	98162906	missense	probably benign	0.07
R1463:Adam30	UTSW	3	98162525	missense	probably damaging	1.00
R1771:Adam30	UTSW	3	98161519	missense	possibly damaging	0.94
R1862:Adam30	UTSW	3	98162113	nonsense	probably null
R3442:Adam30	UTSW	3	98162570	missense	probably benign	0.35
R4125:Adam30	UTSW	3	98161363	missense	probably damaging	1.00
R4714:Adam30	UTSW	3	98162854	missense	probably damaging	1.00
R4816:Adam30	UTSW	3	98162745	missense	possibly damaging	0.68
R5958:Adam30	UTSW	3	98161964	missense	probably damaging	1.00
R6175:Adam30	UTSW	3	98162950	missense	probably damaging	1.00
R6220:Adam30	UTSW	3	98161309	missense	probably damaging	0.98
R6338:Adam30	UTSW	3	98161541	missense	probably damaging	1.00
R6365:Adam30	UTSW	3	98161034	missense	probably damaging	0.99
R6998:Adam30	UTSW	3	98162710	missense	probably benign	0.03
R7086:Adam30	UTSW	3	98161319	missense	probably damaging	1.00
R7290:Adam30	UTSW	3	98162941	missense	probably benign	0.00
R7340:Adam30	UTSW	3	98162321	missense	probably benign	0.14
R8181:Adam30	UTSW	3	98162975	missense	probably benign
R8725:Adam30	UTSW	3	98163032	missense	possibly damaging	0.96
R8727:Adam30	UTSW	3	98163032	missense	possibly damaging	0.96
R8913:Adam30	UTSW	3	98161264	missense	possibly damaging	0.68
R8977:Adam30	UTSW	3	98162062	missense	probably damaging	0.98
R9008:Adam30	UTSW	3	98162718	nonsense	probably null
R9126:Adam30	UTSW	3	98160991	missense	probably benign	0.00
R9181:Adam30	UTSW	3	98162878	missense	probably benign	0.05
R9274:Adam30	UTSW	3	98161951	missense	probably benign	0.06
R9338:Adam30	UTSW	3	98162813	missense	probably damaging	1.00
R9636:Adam30	UTSW	3	98160996	missense	probably benign	0.06
R9640:Adam30	UTSW	3	98162304	missense	probably damaging	1.00
R9651:Adam30	UTSW	3	98162620	missense	possibly damaging	0.92
Z1176:Adam30	UTSW	3	98162360	missense	possibly damaging	0.92
Z1177:Adam30	UTSW	3	98160979	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTTCACTCAAGAGGGCAG -3'
(R):5'- CCTAGACATATTGCCACGGG -3'

Sequencing Primer
(F):5'- CAGTCTGATAGAGGATTATCCGC -3'
(R):5'- GGGCAAACACGAATCTATCCAGG -3'

Posted On

2016-09-06