Incidental Mutation 'R5447:Skint6'
ID429123
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Nameselection and upkeep of intraepithelial T cells 6
SynonymsOTTMUSG00000008519
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112804616-113286973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113105909 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 442 (S442C)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: S442C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: S442C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: S442C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: S442C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Meta Mutation Damage Score 0.1836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 intron probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 intron probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 intron probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 intron probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTAATTTGCCCAGGCTGTATTACAA -3'
(R):5'- TTGGTGACCTAGCTGGAGGC -3'

Sequencing Primer
(F):5'- CCAGGCTGTATTACAAAATCTCTGGG -3'
(R):5'- GAGATCTAATATATGCTCTGCCAAGC -3'
Posted On2016-09-06