Mutagenetix > Incidental Mutation

Incidental Mutation 'R5447:Skint6'

429123

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

043012-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R5447 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113105909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 442 (S442C)

Ref Sequence

ENSEMBL: ENSMUSP00000132312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably benign
Transcript: ENSMUST00000138966
AA Change: S442C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: S442C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171224
AA Change: S442C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: S442C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (71/73)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	C	A	5: 90,584,310	A458E	probably damaging	Het
Abcb5	T	C	12: 118,927,326	I479V	probably damaging	Het
Adam30	A	G	3: 98,161,343	D164G	probably benign	Het
Adgrl3	T	A	5: 81,465,341		probably benign	Het
Adrb1	T	C	19: 56,723,087	I239T	probably benign	Het
B4galnt3	T	C	6: 120,215,057	T572A	probably benign	Het
Baz2b	T	C	2: 59,913,988	E1391G	probably damaging	Het
BC016579	A	G	16: 45,648,889	V72A	probably benign	Het
Btnl10	A	T	11: 58,922,318	I258F	probably benign	Het
Cdh5	A	T	8: 104,129,362	D309V	probably damaging	Het
Cdhr2	A	G	13: 54,733,250	D1042G	probably damaging	Het
Clk2	G	T	3: 89,167,191	V53F	possibly damaging	Het
Cyfip2	T	C	11: 46,291,586	D15G	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Dmbt1	A	G	7: 131,119,511	Y1836C	probably damaging	Het
Dysf	T	C	6: 84,195,263	F1905L	probably damaging	Het
E130114P18Rik	A	G	4: 97,690,718	S7P	unknown	Het
Fam110a	T	C	2: 151,970,709	E47G	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
H2-Ke6	A	T	17: 34,026,912	V202D	probably damaging	Het
Helb	T	A	10: 120,102,901	D556V	possibly damaging	Het
Hoxd4	A	G	2: 74,727,343	E22G	probably damaging	Het
Il1rl2	T	G	1: 40,329,156	I162R	probably damaging	Het
Lhfpl5	A	G	17: 28,576,097	T33A	probably damaging	Het
Mapk8ip3	G	A	17: 24,899,189	A1283V	probably benign	Het
Mettl13	A	G	1: 162,535,880	V227A	probably benign	Het
Mmgt2	T	A	11: 62,664,998	C57*	probably null	Het
Muc4	G	C	16: 32,753,919	R1265P	probably benign	Het
Mylk2	T	C	2: 152,912,510	S175P	probably damaging	Het
Neu4	C	T	1: 94,022,418	T33M	probably damaging	Het
Nfs1	C	T	2: 156,142,136	R107H	probably benign	Het
Nfxl1	C	T	5: 72,529,169	R563Q	probably benign	Het
Nid1	A	G	13: 13,437,910	D70G	probably benign	Het
Nup160	C	A	2: 90,725,615	Q1220K	possibly damaging	Het
Olfr175-ps1	A	T	16: 58,824,483	C75*	probably null	Het
Olfr381	A	G	11: 73,486,176	V216A	probably benign	Het
Olfr51	G	A	11: 51,007,343	V124M	possibly damaging	Het
Olfr605	A	C	7: 103,442,940	M61R	probably damaging	Het
Pdgfrb	T	A	18: 61,068,108	V422E	probably damaging	Het
Pear1	G	A	3: 87,759,142	R85C	probably damaging	Het
Pkhd1	T	A	1: 20,239,385	M2780L	probably benign	Het
Ppp4r4	T	C	12: 103,584,151	V62A	possibly damaging	Het
Prol1	C	T	5: 88,328,266	P172S	unknown	Het
Proz	A	G	8: 13,072,578	I231V	probably benign	Het
Ptch1	T	G	13: 63,527,245	M718L	probably benign	Het
Ptprs	A	G	17: 56,429,128	C102R	possibly damaging	Het
Robo2	A	T	16: 73,973,766	Y490*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Snw1	T	C	12: 87,455,715	E303G	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Stk10	C	T	11: 32,604,166	Q618*	probably null	Het
Tmc3	A	T	7: 83,622,361	E907V	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	T	A	2: 76,899,107		probably benign	Het
Vps39	T	C	2: 120,352,932	D19G	probably benign	Het
Zan	T	C	5: 137,472,191	S229G	probably damaging	Het
Zfp141	A	T	7: 42,475,559	C496*	probably null	Het
Zgrf1	T	C	3: 127,563,119	S665P	possibly damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTAATTTGCCCAGGCTGTATTACAA -3'
(R):5'- TTGGTGACCTAGCTGGAGGC -3'

Sequencing Primer
(F):5'- CCAGGCTGTATTACAAAATCTCTGGG -3'
(R):5'- GAGATCTAATATATGCTCTGCCAAGC -3'

Posted On

2016-09-06