Incidental Mutation 'R5447:Skint6'
ID 429123
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112963106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 442 (S442C)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: S442C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: S442C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: S442C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: S442C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,891,061 (GRCm39) I479V probably damaging Het
Adam30 A G 3: 98,068,659 (GRCm39) D164G probably benign Het
Adgrl3 T A 5: 81,613,188 (GRCm39) probably benign Het
Adrb1 T C 19: 56,711,519 (GRCm39) I239T probably benign Het
Albfm1 C A 5: 90,732,169 (GRCm39) A458E probably damaging Het
B4galnt3 T C 6: 120,192,018 (GRCm39) T572A probably benign Het
Baz2b T C 2: 59,744,332 (GRCm39) E1391G probably damaging Het
BC016579 A G 16: 45,469,252 (GRCm39) V72A probably benign Het
Btnl10 A T 11: 58,813,144 (GRCm39) I258F probably benign Het
Cdh5 A T 8: 104,855,994 (GRCm39) D309V probably damaging Het
Cdhr2 A G 13: 54,881,063 (GRCm39) D1042G probably damaging Het
Clk2 G T 3: 89,074,498 (GRCm39) V53F possibly damaging Het
Cyfip2 T C 11: 46,182,413 (GRCm39) D15G possibly damaging Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Dmbt1 A G 7: 130,721,240 (GRCm39) Y1836C probably damaging Het
Dysf T C 6: 84,172,245 (GRCm39) F1905L probably damaging Het
E130114P18Rik A G 4: 97,578,955 (GRCm39) S7P unknown Het
Fam110a T C 2: 151,812,629 (GRCm39) E47G probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Helb T A 10: 119,938,806 (GRCm39) D556V possibly damaging Het
Hoxd4 A G 2: 74,557,687 (GRCm39) E22G probably damaging Het
Hsd17b8 A T 17: 34,245,886 (GRCm39) V202D probably damaging Het
Il1rl2 T G 1: 40,368,316 (GRCm39) I162R probably damaging Het
Lhfpl5 A G 17: 28,795,071 (GRCm39) T33A probably damaging Het
Mapk8ip3 G A 17: 25,118,163 (GRCm39) A1283V probably benign Het
Mettl13 A G 1: 162,363,449 (GRCm39) V227A probably benign Het
Mmgt2 T A 11: 62,555,824 (GRCm39) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,754,430 (GRCm39) S175P probably damaging Het
Neu4 C T 1: 93,950,140 (GRCm39) T33M probably damaging Het
Nfs1 C T 2: 155,984,056 (GRCm39) R107H probably benign Het
Nfxl1 C T 5: 72,686,512 (GRCm39) R563Q probably benign Het
Nid1 A G 13: 13,612,495 (GRCm39) D70G probably benign Het
Nup160 C A 2: 90,555,959 (GRCm39) Q1220K possibly damaging Het
Or1ad8 G A 11: 50,898,170 (GRCm39) V124M possibly damaging Het
Or1e22 A G 11: 73,377,002 (GRCm39) V216A probably benign Het
Or52s6 A C 7: 103,092,147 (GRCm39) M61R probably damaging Het
Or5k8 A T 16: 58,644,846 (GRCm39) C75* probably null Het
Pdgfrb T A 18: 61,201,180 (GRCm39) V422E probably damaging Het
Pear1 G A 3: 87,666,449 (GRCm39) R85C probably damaging Het
Pkhd1 T A 1: 20,309,609 (GRCm39) M2780L probably benign Het
Ppp4r4 T C 12: 103,550,410 (GRCm39) V62A possibly damaging Het
Prol1 C T 5: 88,476,125 (GRCm39) P172S unknown Het
Proz A G 8: 13,122,578 (GRCm39) I231V probably benign Het
Ptch1 T G 13: 63,675,059 (GRCm39) M718L probably benign Het
Ptprs A G 17: 56,736,128 (GRCm39) C102R possibly damaging Het
Robo2 A T 16: 73,770,654 (GRCm39) Y490* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Snw1 T C 12: 87,502,485 (GRCm39) E303G probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Stk10 C T 11: 32,554,166 (GRCm39) Q618* probably null Het
Tmc3 A T 7: 83,271,569 (GRCm39) E907V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T A 2: 76,729,451 (GRCm39) probably benign Het
Vps39 T C 2: 120,183,413 (GRCm39) D19G probably benign Het
Zan T C 5: 137,470,453 (GRCm39) S229G probably damaging Het
Zfp141 A T 7: 42,124,983 (GRCm39) C496* probably null Het
Zgrf1 T C 3: 127,356,768 (GRCm39) S665P possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAATTTGCCCAGGCTGTATTACAA -3'
(R):5'- TTGGTGACCTAGCTGGAGGC -3'

Sequencing Primer
(F):5'- CCAGGCTGTATTACAAAATCTCTGGG -3'
(R):5'- GAGATCTAATATATGCTCTGCCAAGC -3'
Posted On 2016-09-06