Incidental Mutation 'R5447:Dmbt1'
ID 429134
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 130633787-130723357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130721240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1836 (Y1836C)
Ref Sequence ENSEMBL: ENSMUSP00000081556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084509
AA Change: Y1836C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: Y1836C

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: Y1847C
Predicted Effect unknown
Transcript: ENSMUST00000209015
AA Change: Y7C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209167
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: Y1673C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.7020 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,891,061 (GRCm39) I479V probably damaging Het
Adam30 A G 3: 98,068,659 (GRCm39) D164G probably benign Het
Adgrl3 T A 5: 81,613,188 (GRCm39) probably benign Het
Adrb1 T C 19: 56,711,519 (GRCm39) I239T probably benign Het
Albfm1 C A 5: 90,732,169 (GRCm39) A458E probably damaging Het
B4galnt3 T C 6: 120,192,018 (GRCm39) T572A probably benign Het
Baz2b T C 2: 59,744,332 (GRCm39) E1391G probably damaging Het
BC016579 A G 16: 45,469,252 (GRCm39) V72A probably benign Het
Btnl10 A T 11: 58,813,144 (GRCm39) I258F probably benign Het
Cdh5 A T 8: 104,855,994 (GRCm39) D309V probably damaging Het
Cdhr2 A G 13: 54,881,063 (GRCm39) D1042G probably damaging Het
Clk2 G T 3: 89,074,498 (GRCm39) V53F possibly damaging Het
Cyfip2 T C 11: 46,182,413 (GRCm39) D15G possibly damaging Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Dysf T C 6: 84,172,245 (GRCm39) F1905L probably damaging Het
E130114P18Rik A G 4: 97,578,955 (GRCm39) S7P unknown Het
Fam110a T C 2: 151,812,629 (GRCm39) E47G probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Helb T A 10: 119,938,806 (GRCm39) D556V possibly damaging Het
Hoxd4 A G 2: 74,557,687 (GRCm39) E22G probably damaging Het
Hsd17b8 A T 17: 34,245,886 (GRCm39) V202D probably damaging Het
Il1rl2 T G 1: 40,368,316 (GRCm39) I162R probably damaging Het
Lhfpl5 A G 17: 28,795,071 (GRCm39) T33A probably damaging Het
Mapk8ip3 G A 17: 25,118,163 (GRCm39) A1283V probably benign Het
Mettl13 A G 1: 162,363,449 (GRCm39) V227A probably benign Het
Mmgt2 T A 11: 62,555,824 (GRCm39) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,754,430 (GRCm39) S175P probably damaging Het
Neu4 C T 1: 93,950,140 (GRCm39) T33M probably damaging Het
Nfs1 C T 2: 155,984,056 (GRCm39) R107H probably benign Het
Nfxl1 C T 5: 72,686,512 (GRCm39) R563Q probably benign Het
Nid1 A G 13: 13,612,495 (GRCm39) D70G probably benign Het
Nup160 C A 2: 90,555,959 (GRCm39) Q1220K possibly damaging Het
Or1ad8 G A 11: 50,898,170 (GRCm39) V124M possibly damaging Het
Or1e22 A G 11: 73,377,002 (GRCm39) V216A probably benign Het
Or52s6 A C 7: 103,092,147 (GRCm39) M61R probably damaging Het
Or5k8 A T 16: 58,644,846 (GRCm39) C75* probably null Het
Pdgfrb T A 18: 61,201,180 (GRCm39) V422E probably damaging Het
Pear1 G A 3: 87,666,449 (GRCm39) R85C probably damaging Het
Pkhd1 T A 1: 20,309,609 (GRCm39) M2780L probably benign Het
Ppp4r4 T C 12: 103,550,410 (GRCm39) V62A possibly damaging Het
Prol1 C T 5: 88,476,125 (GRCm39) P172S unknown Het
Proz A G 8: 13,122,578 (GRCm39) I231V probably benign Het
Ptch1 T G 13: 63,675,059 (GRCm39) M718L probably benign Het
Ptprs A G 17: 56,736,128 (GRCm39) C102R possibly damaging Het
Robo2 A T 16: 73,770,654 (GRCm39) Y490* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Skint6 T A 4: 112,963,106 (GRCm39) S442C probably benign Het
Snw1 T C 12: 87,502,485 (GRCm39) E303G probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Stk10 C T 11: 32,554,166 (GRCm39) Q618* probably null Het
Tmc3 A T 7: 83,271,569 (GRCm39) E907V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T A 2: 76,729,451 (GRCm39) probably benign Het
Vps39 T C 2: 120,183,413 (GRCm39) D19G probably benign Het
Zan T C 5: 137,470,453 (GRCm39) S229G probably damaging Het
Zfp141 A T 7: 42,124,983 (GRCm39) C496* probably null Het
Zgrf1 T C 3: 127,356,768 (GRCm39) S665P possibly damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 130,681,270 (GRCm39) intron probably benign
IGL00161:Dmbt1 APN 7 130,711,357 (GRCm39) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 130,701,020 (GRCm39) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 130,684,230 (GRCm39) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 130,699,337 (GRCm39) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 130,659,888 (GRCm39) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 130,687,098 (GRCm39) splice site probably benign
IGL01317:Dmbt1 APN 7 130,642,921 (GRCm39) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 130,690,497 (GRCm39) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 130,705,409 (GRCm39) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 130,718,457 (GRCm39) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 130,682,915 (GRCm39) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 130,676,149 (GRCm39) intron probably benign
IGL02160:Dmbt1 APN 7 130,684,418 (GRCm39) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 130,694,986 (GRCm39) splice site probably benign
IGL02197:Dmbt1 APN 7 130,687,152 (GRCm39) splice site probably benign
IGL02332:Dmbt1 APN 7 130,668,343 (GRCm39) intron probably benign
IGL02427:Dmbt1 APN 7 130,689,815 (GRCm39) splice site probably null
IGL02726:Dmbt1 APN 7 130,676,140 (GRCm39) intron probably benign
IGL02967:Dmbt1 APN 7 130,672,919 (GRCm39) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 130,684,409 (GRCm39) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 130,712,778 (GRCm39) missense probably damaging 0.99
cavity UTSW 7 130,713,965 (GRCm39) missense unknown
lacunar UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 130,713,805 (GRCm39) nonsense probably null
K3955:Dmbt1 UTSW 7 130,721,293 (GRCm39) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 130,708,123 (GRCm39) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 130,697,779 (GRCm39) splice site probably benign
R0427:Dmbt1 UTSW 7 130,642,632 (GRCm39) nonsense probably null
R0478:Dmbt1 UTSW 7 130,642,917 (GRCm39) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 130,699,403 (GRCm39) splice site probably null
R0538:Dmbt1 UTSW 7 130,651,631 (GRCm39) splice site probably benign
R0626:Dmbt1 UTSW 7 130,703,811 (GRCm39) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 130,699,383 (GRCm39) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 130,694,847 (GRCm39) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 130,676,254 (GRCm39) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 130,651,944 (GRCm39) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 130,646,217 (GRCm39) splice site probably benign
R1463:Dmbt1 UTSW 7 130,711,366 (GRCm39) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 130,676,061 (GRCm39) intron probably benign
R1990:Dmbt1 UTSW 7 130,660,018 (GRCm39) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 130,708,089 (GRCm39) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 130,700,863 (GRCm39) missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 130,651,748 (GRCm39) missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 130,703,762 (GRCm39) missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 130,699,305 (GRCm39) missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 130,648,292 (GRCm39) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 130,692,224 (GRCm39) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 130,708,198 (GRCm39) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 130,696,464 (GRCm39) nonsense probably null
R3014:Dmbt1 UTSW 7 130,633,827 (GRCm39) intron probably benign
R3155:Dmbt1 UTSW 7 130,651,887 (GRCm39) nonsense probably null
R3176:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3276:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 130,707,979 (GRCm39) missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 130,713,819 (GRCm39) missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 130,675,932 (GRCm39) intron probably benign
R4396:Dmbt1 UTSW 7 130,718,361 (GRCm39) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 130,642,664 (GRCm39) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 130,651,742 (GRCm39) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 130,696,472 (GRCm39) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 130,699,400 (GRCm39) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 130,696,465 (GRCm39) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 130,684,349 (GRCm39) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 130,642,751 (GRCm39) missense probably damaging 1.00
R5467:Dmbt1 UTSW 7 130,642,723 (GRCm39) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 130,665,133 (GRCm39) intron probably benign
R5526:Dmbt1 UTSW 7 130,642,920 (GRCm39) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 130,701,030 (GRCm39) nonsense probably null
R5566:Dmbt1 UTSW 7 130,708,003 (GRCm39) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 130,655,797 (GRCm39) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 130,711,370 (GRCm39) splice site probably null
R6188:Dmbt1 UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 130,705,308 (GRCm39) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 130,718,370 (GRCm39) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 130,648,240 (GRCm39) splice site probably null
R6719:Dmbt1 UTSW 7 130,721,332 (GRCm39) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 130,648,291 (GRCm39) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 130,668,464 (GRCm39) nonsense probably null
R7191:Dmbt1 UTSW 7 130,646,250 (GRCm39) missense unknown
R7269:Dmbt1 UTSW 7 130,668,351 (GRCm39) missense unknown
R7288:Dmbt1 UTSW 7 130,685,519 (GRCm39) nonsense probably null
R7296:Dmbt1 UTSW 7 130,713,861 (GRCm39) missense unknown
R7349:Dmbt1 UTSW 7 130,642,854 (GRCm39) missense unknown
R7386:Dmbt1 UTSW 7 130,713,965 (GRCm39) missense unknown
R7428:Dmbt1 UTSW 7 130,710,192 (GRCm39) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 130,681,241 (GRCm39) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 130,668,192 (GRCm39) missense unknown
R7513:Dmbt1 UTSW 7 130,692,242 (GRCm39) missense unknown
R7553:Dmbt1 UTSW 7 130,706,597 (GRCm39) missense unknown
R7567:Dmbt1 UTSW 7 130,663,093 (GRCm39) splice site probably null
R7584:Dmbt1 UTSW 7 130,690,481 (GRCm39) nonsense probably null
R7736:Dmbt1 UTSW 7 130,718,625 (GRCm39) missense unknown
R7758:Dmbt1 UTSW 7 130,722,926 (GRCm39) missense unknown
R7928:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 130,690,500 (GRCm39) missense unknown
R8098:Dmbt1 UTSW 7 130,710,188 (GRCm39) nonsense probably null
R8125:Dmbt1 UTSW 7 130,700,953 (GRCm39) missense unknown
R8177:Dmbt1 UTSW 7 130,708,162 (GRCm39) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 130,668,330 (GRCm39) missense unknown
R8378:Dmbt1 UTSW 7 130,708,195 (GRCm39) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8400:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8445:Dmbt1 UTSW 7 130,692,110 (GRCm39) missense unknown
R8450:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 130,703,742 (GRCm39) missense unknown
R8688:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense unknown
R8850:Dmbt1 UTSW 7 130,692,134 (GRCm39) missense unknown
R8852:Dmbt1 UTSW 7 130,642,853 (GRCm39) missense unknown
R8871:Dmbt1 UTSW 7 130,718,597 (GRCm39) missense unknown
R8943:Dmbt1 UTSW 7 130,721,372 (GRCm39) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 130,639,611 (GRCm39) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 130,713,798 (GRCm39) missense unknown
R9020:Dmbt1 UTSW 7 130,712,787 (GRCm39) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 130,718,418 (GRCm39) missense unknown
R9230:Dmbt1 UTSW 7 130,639,642 (GRCm39) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 130,700,855 (GRCm39) missense unknown
R9377:Dmbt1 UTSW 7 130,694,832 (GRCm39) missense unknown
R9428:Dmbt1 UTSW 7 130,668,208 (GRCm39) missense unknown
R9474:Dmbt1 UTSW 7 130,675,987 (GRCm39) missense unknown
R9573:Dmbt1 UTSW 7 130,657,910 (GRCm39) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 130,712,652 (GRCm39) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 130,660,015 (GRCm39) missense unknown
R9781:Dmbt1 UTSW 7 130,639,599 (GRCm39) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 130,713,977 (GRCm39) nonsense probably null
X0062:Dmbt1 UTSW 7 130,696,581 (GRCm39) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 130,690,542 (GRCm39) missense unknown
Z1177:Dmbt1 UTSW 7 130,684,215 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAATGAGTGTGTGGAGGCAC -3'
(R):5'- ATTTGAGCGTAACCACCTACC -3'

Sequencing Primer
(F):5'- TCAGGCAGCCAAGGTGAC -3'
(R):5'- ACCGAGGCTCCTCTTTTCTTTG -3'
Posted On 2016-09-06