Incidental Mutation 'R5447:Stk10'
ID 429139
Institutional Source Beutler Lab
Gene Symbol Stk10
Ensembl Gene ENSMUSG00000020272
Gene Name serine/threonine kinase 10
Synonyms Lok, Gek1
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 32483305-32574587 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 32554166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 618 (Q618*)
Ref Sequence ENSEMBL: ENSMUSP00000099885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102821]
AlphaFold O55098
Predicted Effect probably null
Transcript: ENSMUST00000102821
AA Change: Q618*
SMART Domains Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: Q618*

DomainStartEndE-ValueType
S_TKc 36 294 8.66e-92 SMART
low complexity region 316 334 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
Pfam:PKK 586 724 1.9e-41 PFAM
Pfam:PKK 754 894 2.2e-37 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,891,061 (GRCm39) I479V probably damaging Het
Adam30 A G 3: 98,068,659 (GRCm39) D164G probably benign Het
Adgrl3 T A 5: 81,613,188 (GRCm39) probably benign Het
Adrb1 T C 19: 56,711,519 (GRCm39) I239T probably benign Het
Albfm1 C A 5: 90,732,169 (GRCm39) A458E probably damaging Het
B4galnt3 T C 6: 120,192,018 (GRCm39) T572A probably benign Het
Baz2b T C 2: 59,744,332 (GRCm39) E1391G probably damaging Het
BC016579 A G 16: 45,469,252 (GRCm39) V72A probably benign Het
Btnl10 A T 11: 58,813,144 (GRCm39) I258F probably benign Het
Cdh5 A T 8: 104,855,994 (GRCm39) D309V probably damaging Het
Cdhr2 A G 13: 54,881,063 (GRCm39) D1042G probably damaging Het
Clk2 G T 3: 89,074,498 (GRCm39) V53F possibly damaging Het
Cyfip2 T C 11: 46,182,413 (GRCm39) D15G possibly damaging Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Dmbt1 A G 7: 130,721,240 (GRCm39) Y1836C probably damaging Het
Dysf T C 6: 84,172,245 (GRCm39) F1905L probably damaging Het
E130114P18Rik A G 4: 97,578,955 (GRCm39) S7P unknown Het
Fam110a T C 2: 151,812,629 (GRCm39) E47G probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Helb T A 10: 119,938,806 (GRCm39) D556V possibly damaging Het
Hoxd4 A G 2: 74,557,687 (GRCm39) E22G probably damaging Het
Hsd17b8 A T 17: 34,245,886 (GRCm39) V202D probably damaging Het
Il1rl2 T G 1: 40,368,316 (GRCm39) I162R probably damaging Het
Lhfpl5 A G 17: 28,795,071 (GRCm39) T33A probably damaging Het
Mapk8ip3 G A 17: 25,118,163 (GRCm39) A1283V probably benign Het
Mettl13 A G 1: 162,363,449 (GRCm39) V227A probably benign Het
Mmgt2 T A 11: 62,555,824 (GRCm39) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,754,430 (GRCm39) S175P probably damaging Het
Neu4 C T 1: 93,950,140 (GRCm39) T33M probably damaging Het
Nfs1 C T 2: 155,984,056 (GRCm39) R107H probably benign Het
Nfxl1 C T 5: 72,686,512 (GRCm39) R563Q probably benign Het
Nid1 A G 13: 13,612,495 (GRCm39) D70G probably benign Het
Nup160 C A 2: 90,555,959 (GRCm39) Q1220K possibly damaging Het
Or1ad8 G A 11: 50,898,170 (GRCm39) V124M possibly damaging Het
Or1e22 A G 11: 73,377,002 (GRCm39) V216A probably benign Het
Or52s6 A C 7: 103,092,147 (GRCm39) M61R probably damaging Het
Or5k8 A T 16: 58,644,846 (GRCm39) C75* probably null Het
Pdgfrb T A 18: 61,201,180 (GRCm39) V422E probably damaging Het
Pear1 G A 3: 87,666,449 (GRCm39) R85C probably damaging Het
Pkhd1 T A 1: 20,309,609 (GRCm39) M2780L probably benign Het
Ppp4r4 T C 12: 103,550,410 (GRCm39) V62A possibly damaging Het
Prol1 C T 5: 88,476,125 (GRCm39) P172S unknown Het
Proz A G 8: 13,122,578 (GRCm39) I231V probably benign Het
Ptch1 T G 13: 63,675,059 (GRCm39) M718L probably benign Het
Ptprs A G 17: 56,736,128 (GRCm39) C102R possibly damaging Het
Robo2 A T 16: 73,770,654 (GRCm39) Y490* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Skint6 T A 4: 112,963,106 (GRCm39) S442C probably benign Het
Snw1 T C 12: 87,502,485 (GRCm39) E303G probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Tmc3 A T 7: 83,271,569 (GRCm39) E907V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T A 2: 76,729,451 (GRCm39) probably benign Het
Vps39 T C 2: 120,183,413 (GRCm39) D19G probably benign Het
Zan T C 5: 137,470,453 (GRCm39) S229G probably damaging Het
Zfp141 A T 7: 42,124,983 (GRCm39) C496* probably null Het
Zgrf1 T C 3: 127,356,768 (GRCm39) S665P possibly damaging Het
Other mutations in Stk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Stk10 APN 11 32,527,740 (GRCm39) missense probably benign 0.33
IGL01285:Stk10 APN 11 32,560,653 (GRCm39) missense possibly damaging 0.91
IGL01983:Stk10 APN 11 32,539,460 (GRCm39) missense probably benign 0.05
IGL03177:Stk10 APN 11 32,564,592 (GRCm39) missense probably damaging 1.00
IGL03183:Stk10 APN 11 32,554,143 (GRCm39) missense possibly damaging 0.50
coquet UTSW 11 32,527,764 (GRCm39) missense
legacy UTSW 11 32,554,166 (GRCm39) nonsense probably null
mignon UTSW 11 32,537,363 (GRCm39) missense probably damaging 1.00
R0481_stk10_383 UTSW 11 32,564,708 (GRCm39) missense probably damaging 1.00
FR4976:Stk10 UTSW 11 32,564,520 (GRCm39) critical splice acceptor site probably benign
R0003:Stk10 UTSW 11 32,539,460 (GRCm39) missense probably benign 0.05
R0008:Stk10 UTSW 11 32,537,305 (GRCm39) splice site probably benign
R0056:Stk10 UTSW 11 32,567,851 (GRCm39) missense possibly damaging 0.95
R0076:Stk10 UTSW 11 32,553,722 (GRCm39) missense probably benign
R0227:Stk10 UTSW 11 32,567,859 (GRCm39) missense probably damaging 1.00
R0440:Stk10 UTSW 11 32,554,190 (GRCm39) missense probably damaging 1.00
R0454:Stk10 UTSW 11 32,546,724 (GRCm39) missense probably damaging 0.99
R0481:Stk10 UTSW 11 32,564,708 (GRCm39) missense probably damaging 1.00
R0504:Stk10 UTSW 11 32,567,882 (GRCm39) missense probably benign 0.04
R0790:Stk10 UTSW 11 32,548,653 (GRCm39) missense probably benign 0.00
R1439:Stk10 UTSW 11 32,567,919 (GRCm39) missense probably damaging 0.98
R1539:Stk10 UTSW 11 32,483,440 (GRCm39) missense possibly damaging 0.85
R1770:Stk10 UTSW 11 32,572,464 (GRCm39) missense possibly damaging 0.94
R4304:Stk10 UTSW 11 32,560,634 (GRCm39) missense probably damaging 0.97
R4430:Stk10 UTSW 11 32,483,552 (GRCm39) missense possibly damaging 0.81
R4702:Stk10 UTSW 11 32,505,172 (GRCm39) missense probably benign 0.28
R4797:Stk10 UTSW 11 32,548,471 (GRCm39) missense probably benign 0.01
R5801:Stk10 UTSW 11 32,546,748 (GRCm39) missense probably benign 0.01
R5802:Stk10 UTSW 11 32,546,748 (GRCm39) missense probably benign 0.01
R6129:Stk10 UTSW 11 32,565,871 (GRCm39) missense probably damaging 1.00
R6154:Stk10 UTSW 11 32,553,654 (GRCm39) splice site probably null
R6175:Stk10 UTSW 11 32,553,761 (GRCm39) missense possibly damaging 0.46
R6185:Stk10 UTSW 11 32,527,749 (GRCm39) missense probably benign 0.13
R6520:Stk10 UTSW 11 32,538,839 (GRCm39) missense probably damaging 1.00
R6824:Stk10 UTSW 11 32,537,363 (GRCm39) missense probably damaging 1.00
R7259:Stk10 UTSW 11 32,548,497 (GRCm39) missense probably benign 0.00
R7649:Stk10 UTSW 11 32,527,764 (GRCm39) missense
R8331:Stk10 UTSW 11 32,538,928 (GRCm39) missense
R8847:Stk10 UTSW 11 32,539,427 (GRCm39) missense
R9252:Stk10 UTSW 11 32,538,915 (GRCm39) missense
R9367:Stk10 UTSW 11 32,538,878 (GRCm39) missense
X0027:Stk10 UTSW 11 32,537,361 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATCCCCTGTGTGGAGTGC -3'
(R):5'- ATAGCTTTGTGGCTGGGCAC -3'

Sequencing Primer
(F):5'- ACAGAGAGGTTAAGTAACTTGCCCTG -3'
(R):5'- TCATTTGGAAAGCTGGACCC -3'
Posted On 2016-09-06