Incidental Mutation 'R5447:Olfr51'
ID429141
Institutional Source Beutler Lab
Gene Symbol Olfr51
Ensembl Gene ENSMUSG00000060918
Gene Nameolfactory receptor 51
SynonymsMOR129-3, ID7, GA_x6K02T2QP88-4431129-4430206
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location51003596-51009676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51007343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 124 (V124M)
Ref Sequence ENSEMBL: ENSMUSP00000151005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076514] [ENSMUST00000213415]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076514
AA Change: V124M

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075832
Gene: ENSMUSG00000060918
AA Change: V124M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.4e-50 PFAM
Pfam:7tm_1 41 289 8.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213415
AA Change: V124M

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Olfr51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr51 APN 11 51007766 missense probably benign 0.15
IGL02729:Olfr51 APN 11 51007065 missense probably damaging 1.00
R0367:Olfr51 UTSW 11 51007077 missense probably damaging 1.00
R1675:Olfr51 UTSW 11 51007637 missense probably benign 0.01
R1716:Olfr51 UTSW 11 51007852 missense probably damaging 1.00
R1943:Olfr51 UTSW 11 51007675 missense probably benign 0.42
R3027:Olfr51 UTSW 11 51007052 missense possibly damaging 0.77
R4569:Olfr51 UTSW 11 51007554 missense possibly damaging 0.94
R5190:Olfr51 UTSW 11 51007554 missense probably damaging 0.98
R5560:Olfr51 UTSW 11 51007523 missense possibly damaging 0.61
R6396:Olfr51 UTSW 11 51007485 missense possibly damaging 0.46
R6943:Olfr51 UTSW 11 51007326 missense probably damaging 1.00
R7199:Olfr51 UTSW 11 51007396 nonsense probably null
R7991:Olfr51 UTSW 11 51007244 missense possibly damaging 0.48
R8118:Olfr51 UTSW 11 51007500 missense probably damaging 1.00
R8178:Olfr51 UTSW 11 51007610 missense probably damaging 1.00
R8496:Olfr51 UTSW 11 51007050 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTATCCTGGCCATCAGCTGTG -3'
(R):5'- CAGAAGAAGTGGTGCACTGC -3'

Sequencing Primer
(F):5'- TGGCCAACCTCTCCAGTG -3'
(R):5'- GCACTGCATTGTGGGAAC -3'
Posted On2016-09-06