Incidental Mutation 'R5447:Olfr381'
ID429144
Institutional Source Beutler Lab
Gene Symbol Olfr381
Ensembl Gene ENSMUSG00000072708
Gene Nameolfactory receptor 381
SynonymsGA_x6K02T2P1NL-3646409-3645474, MOR135-4
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73484274-73491603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73486176 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 216 (V216A)
Ref Sequence ENSEMBL: ENSMUSP00000149355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078358] [ENSMUST00000119863] [ENSMUST00000214623] [ENSMUST00000215358]
Predicted Effect probably benign
Transcript: ENSMUST00000078358
AA Change: V216A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077467
Gene: ENSMUSG00000072708
AA Change: V216A

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.3e-35 PFAM
Pfam:7tm_4 139 283 5.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119863
AA Change: V216A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113846
Gene: ENSMUSG00000072708
AA Change: V216A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-57 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206673
Predicted Effect probably benign
Transcript: ENSMUST00000214623
AA Change: V216A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000215358
AA Change: V216A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Olfr381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr381 APN 11 73486572 missense probably benign 0.22
IGL02867:Olfr381 APN 11 73485991 missense probably damaging 1.00
IGL03202:Olfr381 APN 11 73486525 nonsense probably null
R0207:Olfr381 UTSW 11 73486575 missense probably benign 0.00
R0539:Olfr381 UTSW 11 73486063 missense probably benign 0.22
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1835:Olfr381 UTSW 11 73486374 missense probably benign 0.08
R2095:Olfr381 UTSW 11 73486594 missense probably damaging 1.00
R3612:Olfr381 UTSW 11 73485940 missense probably benign 0.23
R3983:Olfr381 UTSW 11 73486135 missense possibly damaging 0.84
R4959:Olfr381 UTSW 11 73486067 nonsense probably null
R4983:Olfr381 UTSW 11 73486797 missense probably benign 0.04
R5297:Olfr381 UTSW 11 73486389 missense probably damaging 0.99
R5569:Olfr381 UTSW 11 73486692 missense probably damaging 0.97
R5580:Olfr381 UTSW 11 73486210 missense probably benign
R5711:Olfr381 UTSW 11 73486182 missense probably damaging 1.00
R5810:Olfr381 UTSW 11 73486095 nonsense probably null
R6974:Olfr381 UTSW 11 73486473 missense probably benign 0.00
R7383:Olfr381 UTSW 11 73485889 makesense probably null
R7661:Olfr381 UTSW 11 73486600 missense probably damaging 1.00
R7748:Olfr381 UTSW 11 73486168 missense probably benign 0.03
R7913:Olfr381 UTSW 11 73486398 missense probably benign 0.01
Z1177:Olfr381 UTSW 11 73486153 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTCAGCATGGGAGTCACCAC -3'
(R):5'- TATGCTGTATTCCATGTTGCACAC -3'

Sequencing Primer
(F):5'- GAGTCACCACTGTGTACATCATGG -3'
(R):5'- GCACACTCTACTCTTGGCTAGATTG -3'
Posted On2016-09-06