Incidental Mutation 'R5447:Rptor'
ID429146
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Nameregulatory associated protein of MTOR, complex 1
Synonymsraptor, Rap, 4932417H02Rik
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119602905-119899576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119843713 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 514 (G514D)
Ref Sequence ENSEMBL: ENSMUSP00000026671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000124401] [ENSMUST00000139728] [ENSMUST00000147781]
Predicted Effect probably damaging
Transcript: ENSMUST00000026671
AA Change: G514D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: G514D

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124401
AA Change: G36D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125503
Gene: ENSMUSG00000025583
AA Change: G36D

DomainStartEndE-ValueType
Pfam:HEAT 58 88 1.2e-5 PFAM
Pfam:HEAT_2 101 170 3.9e-8 PFAM
Pfam:HEAT 102 130 1.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127899
Predicted Effect probably benign
Transcript: ENSMUST00000139728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147772
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Meta Mutation Damage Score 0.7267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119799445 missense possibly damaging 0.92
IGL01319:Rptor APN 11 119891170 missense probably benign 0.01
IGL01375:Rptor APN 11 119896436 missense possibly damaging 0.68
IGL01899:Rptor APN 11 119857453 missense probably benign 0.04
IGL01927:Rptor APN 11 119657674 missense probably damaging 1.00
IGL02312:Rptor APN 11 119846915 missense possibly damaging 0.84
IGL02620:Rptor APN 11 119780587 missense probably benign 0.12
IGL02651:Rptor APN 11 119892612 missense possibly damaging 0.69
IGL03182:Rptor APN 11 119725145 missense probably damaging 1.00
Velocipede UTSW 11 119895977 missense possibly damaging 0.92
R0103:Rptor UTSW 11 119884967 missense probably benign 0.01
R0179:Rptor UTSW 11 119872367 missense probably benign 0.14
R0217:Rptor UTSW 11 119894912 splice site probably benign
R0219:Rptor UTSW 11 119821777 intron probably benign
R0324:Rptor UTSW 11 119892641 missense probably damaging 1.00
R0432:Rptor UTSW 11 119780553 nonsense probably null
R0718:Rptor UTSW 11 119872376 missense probably benign 0.15
R0730:Rptor UTSW 11 119884954 missense probably benign 0.06
R1019:Rptor UTSW 11 119843743 missense probably damaging 1.00
R1073:Rptor UTSW 11 119743891 missense possibly damaging 0.93
R1424:Rptor UTSW 11 119780593 nonsense probably null
R1579:Rptor UTSW 11 119896001 missense probably benign 0.00
R1766:Rptor UTSW 11 119725061 missense probably damaging 0.99
R1844:Rptor UTSW 11 119756320 missense probably damaging 1.00
R2180:Rptor UTSW 11 119725144 missense probably damaging 1.00
R2274:Rptor UTSW 11 119756322 nonsense probably null
R2275:Rptor UTSW 11 119756322 nonsense probably null
R2408:Rptor UTSW 11 119857451 missense probably damaging 0.99
R2981:Rptor UTSW 11 119865594 missense probably damaging 1.00
R2996:Rptor UTSW 11 119856298 missense probably damaging 1.00
R3001:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3002:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3003:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R4358:Rptor UTSW 11 119671345 missense probably damaging 0.98
R4592:Rptor UTSW 11 119798840 missense probably null 1.00
R4647:Rptor UTSW 11 119891163 missense probably benign 0.33
R4666:Rptor UTSW 11 119743882 missense probably damaging 1.00
R4958:Rptor UTSW 11 119857391 missense probably benign 0.29
R4974:Rptor UTSW 11 119821640 intron probably benign
R5073:Rptor UTSW 11 119896479 missense possibly damaging 0.71
R5199:Rptor UTSW 11 119603816 missense probably benign
R5216:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5219:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5277:Rptor UTSW 11 119822956 missense probably damaging 1.00
R5365:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5366:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5630:Rptor UTSW 11 119756249 missense probably benign 0.01
R6220:Rptor UTSW 11 119897442 missense possibly damaging 0.83
R6567:Rptor UTSW 11 119896012 missense probably benign 0.00
R6741:Rptor UTSW 11 119895977 missense possibly damaging 0.92
R6915:Rptor UTSW 11 119756345 missense probably damaging 0.99
R7032:Rptor UTSW 11 119846936 missense probably benign 0.00
R7051:Rptor UTSW 11 119874186 utr 3 prime probably benign
R7396:Rptor UTSW 11 119872355 missense probably benign 0.10
R7429:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7430:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7447:Rptor UTSW 11 119884979 missense probably benign 0.00
R7595:Rptor UTSW 11 119743953 missense possibly damaging 0.82
R7776:Rptor UTSW 11 119892627 missense probably benign 0.01
R7854:Rptor UTSW 11 119857953 missense probably benign 0.02
R7937:Rptor UTSW 11 119857953 missense probably benign 0.02
X0050:Rptor UTSW 11 119846405 missense probably benign 0.14
X0066:Rptor UTSW 11 119857866 missense probably benign 0.31
Z0001:Rptor UTSW 11 119603972 critical splice donor site probably null
Z0001:Rptor UTSW 11 119756236 splice site probably null
Z0001:Rptor UTSW 11 119756415 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119799319 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119846752 critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119851468 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119857453 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119871492 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119874151 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119896549 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTTTCCCAAGTGAAATCTG -3'
(R):5'- GGAAGACCAGATTCTCACCCAG -3'

Sequencing Primer
(F):5'- CAAGTGAAATCTGGCCTTGC -3'
(R):5'- ATTCTCACCCAGGGCAGGAAG -3'
Posted On2016-09-06