Incidental Mutation 'R5447:Snw1'
ID429147
Institutional Source Beutler Lab
Gene Symbol Snw1
Ensembl Gene ENSMUSG00000021039
Gene NameSNW domain containing 1
SynonymsSkiip, SKIP, NCoA-62, 2310008B08Rik, SNW1
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87449075-87472274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87455715 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 303 (E303G)
Ref Sequence ENSEMBL: ENSMUSP00000021428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021428] [ENSMUST00000161023]
Predicted Effect probably benign
Transcript: ENSMUST00000021428
AA Change: E303G

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021428
Gene: ENSMUSG00000021039
AA Change: E303G

DomainStartEndE-ValueType
Pfam:SKIP_SNW 175 335 2e-78 PFAM
low complexity region 524 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161023
SMART Domains Protein: ENSMUSP00000125341
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 1.73e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222579
Meta Mutation Damage Score 0.1957 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNW gene family, encodes a coactivator that enhances transcription from some Pol II promoters. This coactivator can bind to the ligand-binding domain of the vitamin D receptor and to retinoid receptors to enhance vitamin D-, retinoic acid-, estrogen-, and glucocorticoid-mediated gene expression. It can also function as a splicing factor by interacting with poly(A)-binding protein 2 to directly control the expression of muscle-specific genes at the transcriptional level. Finally, the protein may be involved in oncogenesis since it interacts with a region of SKI oncoproteins that is required for transforming activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Snw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Snw1 APN 12 87452580 critical splice donor site probably null
IGL00559:Snw1 APN 12 87468731 missense probably damaging 0.98
IGL00561:Snw1 APN 12 87450804 critical splice donor site probably null
IGL01019:Snw1 APN 12 87450941 missense probably benign 0.24
IGL01304:Snw1 APN 12 87453915 missense possibly damaging 0.71
IGL01918:Snw1 APN 12 87455668 missense probably benign 0.14
IGL03170:Snw1 APN 12 87472252 missense probably benign 0.00
R0149:Snw1 UTSW 12 87461917 missense possibly damaging 0.51
R1760:Snw1 UTSW 12 87464689 missense probably benign 0.06
R1935:Snw1 UTSW 12 87459477 missense probably damaging 1.00
R2130:Snw1 UTSW 12 87452703 unclassified probably benign
R2230:Snw1 UTSW 12 87452658 missense probably benign 0.00
R2496:Snw1 UTSW 12 87450819 missense probably benign
R4907:Snw1 UTSW 12 87459489 missense probably benign 0.19
R4926:Snw1 UTSW 12 87452658 missense probably benign 0.00
R5138:Snw1 UTSW 12 87460435 missense probably benign 0.00
R6239:Snw1 UTSW 12 87464628 missense probably damaging 1.00
R6552:Snw1 UTSW 12 87459419 critical splice donor site probably null
R6747:Snw1 UTSW 12 87464710 missense probably damaging 1.00
R7230:Snw1 UTSW 12 87464554 missense probably damaging 1.00
R7242:Snw1 UTSW 12 87468645 missense possibly damaging 0.94
R8184:Snw1 UTSW 12 87453903 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGTGCATGGAGACTTTCTAAAATG -3'
(R):5'- CATCAACTGGACTTGCTGTGG -3'

Sequencing Primer
(F):5'- CTCCACGTGGGTTTTGAT -3'
(R):5'- GCTGTGGTTGCATCATTAAAAC -3'
Posted On2016-09-06