Incidental Mutation 'R5447:Robo2'
ID429156
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 043012-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73973766 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 490 (Y490*)
Ref Sequence ENSEMBL: ENSMUSP00000154010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102329
Predicted Effect probably null
Transcript: ENSMUST00000116586
AA Change: Y490*
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: Y490*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117200
AA Change: Y486*
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: Y486*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117785
AA Change: Y486*
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: Y486*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226478
AA Change: Y490*
Predicted Effect probably null
Transcript: ENSMUST00000227347
AA Change: Y490*
Meta Mutation Damage Score 0.9703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
R7192:Robo2 UTSW 16 73920750 missense probably benign 0.19
R7569:Robo2 UTSW 16 74035115 missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73958405 missense probably damaging 1.00
R7720:Robo2 UTSW 16 73897015 missense probably benign 0.00
R7772:Robo2 UTSW 16 73961889 missense probably benign 0.24
R7822:Robo2 UTSW 16 73973171 missense probably damaging 1.00
R7849:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7897:Robo2 UTSW 16 73898950 missense probably benign
R7932:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7964:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7980:Robo2 UTSW 16 73898950 missense probably benign
R8135:Robo2 UTSW 16 73933160 missense probably benign 0.04
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73933591 missense probably benign 0.35
Z1177:Robo2 UTSW 16 73940299 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GACACCATGTTATGTGCCAAC -3'
(R):5'- GACAGTGACACAATGGAATCCC -3'

Sequencing Primer
(F):5'- GACACCATGTTATGTGCCAACTAATG -3'
(R):5'- GTGACACAATGGAATCCCACAAG -3'
Posted On2016-09-06