Incidental Mutation 'R5447:Gemin6'
ID 429161
Institutional Source Beutler Lab
Gene Symbol Gemin6
Ensembl Gene ENSMUSG00000055760
Gene Name gem nuclear organelle associated protein 6
Synonyms 2810470M17Rik, 2610019B15Rik
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.749) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 80531870-80535926 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 80535178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 46 (V46G)
Ref Sequence ENSEMBL: ENSMUSP00000063554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069486]
AlphaFold Q9CX53
Predicted Effect probably damaging
Transcript: ENSMUST00000069486
AA Change: V46G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063554
Gene: ENSMUSG00000055760
AA Change: V46G

DomainStartEndE-ValueType
Pfam:Gemin6 1 166 9.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156869
Meta Mutation Damage Score 0.4198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,891,061 (GRCm39) I479V probably damaging Het
Adam30 A G 3: 98,068,659 (GRCm39) D164G probably benign Het
Adgrl3 T A 5: 81,613,188 (GRCm39) probably benign Het
Adrb1 T C 19: 56,711,519 (GRCm39) I239T probably benign Het
Albfm1 C A 5: 90,732,169 (GRCm39) A458E probably damaging Het
B4galnt3 T C 6: 120,192,018 (GRCm39) T572A probably benign Het
Baz2b T C 2: 59,744,332 (GRCm39) E1391G probably damaging Het
BC016579 A G 16: 45,469,252 (GRCm39) V72A probably benign Het
Btnl10 A T 11: 58,813,144 (GRCm39) I258F probably benign Het
Cdh5 A T 8: 104,855,994 (GRCm39) D309V probably damaging Het
Cdhr2 A G 13: 54,881,063 (GRCm39) D1042G probably damaging Het
Clk2 G T 3: 89,074,498 (GRCm39) V53F possibly damaging Het
Cyfip2 T C 11: 46,182,413 (GRCm39) D15G possibly damaging Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Dmbt1 A G 7: 130,721,240 (GRCm39) Y1836C probably damaging Het
Dysf T C 6: 84,172,245 (GRCm39) F1905L probably damaging Het
E130114P18Rik A G 4: 97,578,955 (GRCm39) S7P unknown Het
Fam110a T C 2: 151,812,629 (GRCm39) E47G probably damaging Het
Helb T A 10: 119,938,806 (GRCm39) D556V possibly damaging Het
Hoxd4 A G 2: 74,557,687 (GRCm39) E22G probably damaging Het
Hsd17b8 A T 17: 34,245,886 (GRCm39) V202D probably damaging Het
Il1rl2 T G 1: 40,368,316 (GRCm39) I162R probably damaging Het
Lhfpl5 A G 17: 28,795,071 (GRCm39) T33A probably damaging Het
Mapk8ip3 G A 17: 25,118,163 (GRCm39) A1283V probably benign Het
Mettl13 A G 1: 162,363,449 (GRCm39) V227A probably benign Het
Mmgt2 T A 11: 62,555,824 (GRCm39) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,754,430 (GRCm39) S175P probably damaging Het
Neu4 C T 1: 93,950,140 (GRCm39) T33M probably damaging Het
Nfs1 C T 2: 155,984,056 (GRCm39) R107H probably benign Het
Nfxl1 C T 5: 72,686,512 (GRCm39) R563Q probably benign Het
Nid1 A G 13: 13,612,495 (GRCm39) D70G probably benign Het
Nup160 C A 2: 90,555,959 (GRCm39) Q1220K possibly damaging Het
Or1ad8 G A 11: 50,898,170 (GRCm39) V124M possibly damaging Het
Or1e22 A G 11: 73,377,002 (GRCm39) V216A probably benign Het
Or52s6 A C 7: 103,092,147 (GRCm39) M61R probably damaging Het
Or5k8 A T 16: 58,644,846 (GRCm39) C75* probably null Het
Pdgfrb T A 18: 61,201,180 (GRCm39) V422E probably damaging Het
Pear1 G A 3: 87,666,449 (GRCm39) R85C probably damaging Het
Pkhd1 T A 1: 20,309,609 (GRCm39) M2780L probably benign Het
Ppp4r4 T C 12: 103,550,410 (GRCm39) V62A possibly damaging Het
Prol1 C T 5: 88,476,125 (GRCm39) P172S unknown Het
Proz A G 8: 13,122,578 (GRCm39) I231V probably benign Het
Ptch1 T G 13: 63,675,059 (GRCm39) M718L probably benign Het
Ptprs A G 17: 56,736,128 (GRCm39) C102R possibly damaging Het
Robo2 A T 16: 73,770,654 (GRCm39) Y490* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Skint6 T A 4: 112,963,106 (GRCm39) S442C probably benign Het
Snw1 T C 12: 87,502,485 (GRCm39) E303G probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Stk10 C T 11: 32,554,166 (GRCm39) Q618* probably null Het
Tmc3 A T 7: 83,271,569 (GRCm39) E907V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T A 2: 76,729,451 (GRCm39) probably benign Het
Vps39 T C 2: 120,183,413 (GRCm39) D19G probably benign Het
Zan T C 5: 137,470,453 (GRCm39) S229G probably damaging Het
Zfp141 A T 7: 42,124,983 (GRCm39) C496* probably null Het
Zgrf1 T C 3: 127,356,768 (GRCm39) S665P possibly damaging Het
Other mutations in Gemin6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Gemin6 APN 17 80,535,294 (GRCm39) missense possibly damaging 0.56
IGL02129:Gemin6 APN 17 80,535,355 (GRCm39) missense probably damaging 1.00
R0197:Gemin6 UTSW 17 80,535,524 (GRCm39) missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80,533,139 (GRCm39) missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80,533,139 (GRCm39) missense probably damaging 1.00
R0883:Gemin6 UTSW 17 80,535,524 (GRCm39) missense probably damaging 1.00
R1995:Gemin6 UTSW 17 80,535,414 (GRCm39) missense probably damaging 1.00
R4570:Gemin6 UTSW 17 80,535,498 (GRCm39) nonsense probably null
R4885:Gemin6 UTSW 17 80,535,327 (GRCm39) missense probably damaging 0.99
R5335:Gemin6 UTSW 17 80,533,184 (GRCm39) missense probably damaging 1.00
R5445:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5451:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5452:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5522:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5525:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5526:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R7291:Gemin6 UTSW 17 80,535,204 (GRCm39) missense possibly damaging 0.61
R7576:Gemin6 UTSW 17 80,533,155 (GRCm39) nonsense probably null
R7845:Gemin6 UTSW 17 80,533,090 (GRCm39) missense probably benign 0.00
R8842:Gemin6 UTSW 17 80,533,115 (GRCm39) missense possibly damaging 0.88
R8862:Gemin6 UTSW 17 80,535,432 (GRCm39) missense probably damaging 1.00
R9203:Gemin6 UTSW 17 80,535,237 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCACATTTAAGACAGATGGCC -3'
(R):5'- CCATTTCTTGAGGCTGGTCC -3'

Sequencing Primer
(F):5'- AGGGGCCAAGCTTTTAATCC -3'
(R):5'- GGCTGGTCCTCTTCTCTTCCAG -3'
Posted On 2016-09-06