Incidental Mutation 'R5447:Adrb1'
ID429163
Institutional Source Beutler Lab
Gene Symbol Adrb1
Ensembl Gene ENSMUSG00000035283
Gene Nameadrenergic receptor, beta 1
SynonymsAdrb-1, beta 1-AR
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56722372-56724862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56723087 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 239 (I239T)
Ref Sequence ENSEMBL: ENSMUSP00000040847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038949]
Predicted Effect probably benign
Transcript: ENSMUST00000038949
AA Change: I239T

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040847
Gene: ENSMUSG00000035283
AA Change: I239T

DomainStartEndE-ValueType
low complexity region 19 54 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 266 2.2e-9 PFAM
Pfam:7TM_GPCR_Srsx 69 380 1.4e-18 PFAM
Pfam:7tm_1 75 366 6.1e-82 PFAM
Pfam:7TM_GPCR_Srv 96 382 5.9e-11 PFAM
low complexity region 407 430 N/A INTRINSIC
Meta Mutation Damage Score 0.2287 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adrenergic receptors (subtypes alpha 1, alpha 2, beta 1, and beta 2) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. Specific polymorphisms in this gene have been shown to affect the resting heart rate and can be involved in heart failure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die prenatally, with the penetrance of lethality showing strain dependence. Surviving knockouts appear normal, but lack the chronotropic and inotropic responses seen in wild-type mice when beta-AR agonists such as isoproterenol are administered. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Adrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03237:Adrb1 APN 19 56723368 missense probably damaging 1.00
R0267:Adrb1 UTSW 19 56723491 nonsense probably null
R0352:Adrb1 UTSW 19 56722861 missense probably damaging 1.00
R1652:Adrb1 UTSW 19 56723273 missense possibly damaging 0.67
R4662:Adrb1 UTSW 19 56722774 missense probably damaging 0.99
R6155:Adrb1 UTSW 19 56722904 missense probably damaging 1.00
R6787:Adrb1 UTSW 19 56722589 missense probably damaging 0.99
R6980:Adrb1 UTSW 19 56723614 missense probably benign 0.27
R7064:Adrb1 UTSW 19 56723024 missense probably damaging 1.00
R7560:Adrb1 UTSW 19 56722688 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCGCTACCAGAGTTTGCTG -3'
(R):5'- AGTGTCTTGAGCGCCTTCTG -3'

Sequencing Primer
(F):5'- TACCAGAGTTTGCTGACGCG -3'
(R):5'- GAGCGCCTTCTGCTCGC -3'
Posted On2016-09-06