Incidental Mutation 'R5449:Slc7a5'
ID429227
Institutional Source Beutler Lab
Gene Symbol Slc7a5
Ensembl Gene ENSMUSG00000040010
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 5
SynonymsTA1, D0H16S474E, LAT1
MMRRC Submission 043014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5449 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location121881150-121907694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121886348 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 330 (W330C)
Ref Sequence ENSEMBL: ENSMUSP00000041557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045557] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000045557
AA Change: W330C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041557
Gene: ENSMUSG00000040010
AA Change: W330C

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:AA_permease_2 51 481 4.2e-65 PFAM
Pfam:AA_permease 56 489 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183015
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,264 T163M probably benign Het
4921539E11Rik T A 4: 103,266,382 I98F probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A630010A05Rik A G 16: 14,618,673 K197E possibly damaging Het
Agrn A G 4: 156,167,280 probably null Het
Atad5 A G 11: 80,124,108 I1337V probably damaging Het
Cd44 T C 2: 102,832,546 T550A probably damaging Het
Cdk5rap2 A C 4: 70,276,651 L952V probably benign Het
Cep104 T A 4: 153,985,305 probably null Het
Cfl1 A G 19: 5,493,493 *167W probably null Het
Col22a1 T C 15: 71,821,949 D734G unknown Het
Cry1 G A 10: 85,133,135 L581F probably benign Het
Dmpk A G 7: 19,090,991 D406G probably benign Het
Faah T C 4: 115,999,495 probably null Het
Fchsd2 T C 7: 101,277,524 F607S probably damaging Het
Fga CAAAG CAAAGAAAG 3: 83,030,862 probably null Het
Hdac5 G A 11: 102,196,097 Q46* probably null Het
Hltf A G 3: 20,069,083 T212A possibly damaging Het
Ilvbl G A 10: 78,577,028 probably null Het
Ldhc T C 7: 46,869,658 S102P possibly damaging Het
Med12l T C 3: 59,259,706 V1529A probably damaging Het
Nlrp9a A G 7: 26,557,829 I202V probably benign Het
Pdc A C 1: 150,333,439 L224F probably damaging Het
Pgr T C 9: 8,956,343 V764A possibly damaging Het
Plxna1 T C 6: 89,323,608 D1578G probably damaging Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Ptrh1 A G 2: 32,776,346 S37G probably damaging Het
Rgs9 T C 11: 109,225,744 D411G probably benign Het
Riok3 A T 18: 12,155,246 E493D probably damaging Het
Rnf213 T C 11: 119,415,076 M570T probably benign Het
Scamp2 A G 9: 57,580,871 D187G probably damaging Het
Scn1a T A 2: 66,321,002 I819F probably damaging Het
Syn3 A T 10: 86,351,570 F230Y probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tro T C X: 150,645,970 probably benign Het
Ubr1 T A 2: 120,963,500 M68L probably benign Het
Vmn1r120 A C 7: 21,053,149 H212Q possibly damaging Het
Vmn1r46 T C 6: 89,976,361 V64A probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp384 T C 6: 125,024,138 S58P probably damaging Het
Other mutations in Slc7a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Slc7a5 APN 8 121886390 intron probably benign
R0364:Slc7a5 UTSW 8 121885015 missense probably benign
R0580:Slc7a5 UTSW 8 121885116 missense probably benign 0.21
R0965:Slc7a5 UTSW 8 121907101 missense probably benign 0.01
R1274:Slc7a5 UTSW 8 121883714 missense probably benign 0.44
R2135:Slc7a5 UTSW 8 121883705 missense probably null 0.96
R4163:Slc7a5 UTSW 8 121888400 missense probably benign 0.00
R4506:Slc7a5 UTSW 8 121887495 critical splice donor site probably null
R4910:Slc7a5 UTSW 8 121885122 missense probably damaging 0.96
R5243:Slc7a5 UTSW 8 121896535 missense probably damaging 1.00
R5719:Slc7a5 UTSW 8 121883642 missense probably benign 0.00
R5744:Slc7a5 UTSW 8 121888382 missense probably benign 0.00
R7473:Slc7a5 UTSW 8 121888423 missense probably benign
R7499:Slc7a5 UTSW 8 121883722 missense probably damaging 1.00
R7663:Slc7a5 UTSW 8 121887535 nonsense probably null
R7680:Slc7a5 UTSW 8 121907267 missense probably damaging 1.00
R7682:Slc7a5 UTSW 8 121907140 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGCTGTACCTTACTTCTAGC -3'
(R):5'- CTACAACAAGACTCGGGGATGG -3'

Sequencing Primer
(F):5'- TAGCCCATCGAAGCATTCTATC -3'
(R):5'- GAGACGCTGTGTGTTCCCTC -3'
Posted On2016-09-06