Mutagenetix > Incidental Mutation

Incidental Mutation 'R5450:Sulf1'

429246

Institutional Source

Beutler Lab

Gene Symbol

Sulf1

Ensembl Gene

ENSMUSG00000016918

Gene Name

sulfatase 1

Synonyms

MMRRC Submission

043015-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R5450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12692277-12861192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12796907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 105 (V105A)

Ref Sequence

ENSEMBL: ENSMUSP00000136014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]

AlphaFold

Q8K007

Predicted Effect

probably benign
Transcript: ENSMUST00000088585
AA Change: V105A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: V105A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177608
AA Change: V105A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: V105A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	534	678	9.7e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000180062
AA Change: V105A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: V105A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186051
AA Change: V105A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: V105A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.4e-56	PFAM
Pfam:Phosphodiest	61	323	9.6e-8	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	1.1e-48	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187376

Meta Mutation Damage Score

0.2688

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
AF067063	A	T	13: 119,828,363	V99E	probably damaging	Het
Arhgef4	T	G	1: 34,807,324		probably benign	Het
Atg14	T	C	14: 47,551,464	N144S	probably benign	Het
Cacna1h	A	T	17: 25,383,186	M1454K	probably damaging	Het
Catsperb	A	T	12: 101,446,068	H138L	possibly damaging	Het
Ccdc129	T	A	6: 55,968,811		probably null	Het
Cd200r2	T	A	16: 44,909,571	D159E	probably benign	Het
Cd79a	G	T	7: 24,899,262	G79C	probably damaging	Het
Ceacam20	A	G	7: 19,978,208	H38R	possibly damaging	Het
Cers1	T	C	8: 70,318,297	L119P	probably damaging	Het
Ces1f	C	A	8: 93,265,795	V343L	probably benign	Het
Ces3a	G	A	8: 105,057,918	G511S	possibly damaging	Het
Cyfip2	A	G	11: 46,284,252	C98R	probably benign	Het
Cyp2j11	C	A	4: 96,339,876	V169L	probably benign	Het
Cyp4f17	A	G	17: 32,528,886	T523A	probably benign	Het
Ddx31	T	C	2: 28,886,969	S567P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsg1b	A	C	18: 20,409,064	H876P	probably damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Eno4	T	C	19: 58,960,247	F393S	possibly damaging	Het
Eral1	C	T	11: 78,078,357	D106N	probably benign	Het
Esp18	G	T	17: 39,408,179	R23M	probably benign	Het
Fam184b	C	T	5: 45,539,801	V674I	probably benign	Het
Fbxw13	A	C	9: 109,184,157	N154K	probably benign	Het
Gtpbp6	A	G	5: 110,107,125	V130A	probably damaging	Het
Hc	T	C	2: 35,013,038	D1067G	possibly damaging	Het
Ighg1	A	T	12: 113,330,506	S6T	unknown	Het
Ikzf3	C	T	11: 98,467,086	R475H	probably damaging	Het
Kcmf1	A	T	6: 72,842,930	L311*	probably null	Het
Kmt2d	C	A	15: 98,855,086	E184D	probably damaging	Het
Lrguk	A	T	6: 34,071,061	I314F	probably damaging	Het
Maml2	A	C	9: 13,706,467	S370R	probably damaging	Het
Mroh1	C	A	15: 76,432,347		probably benign	Het
Mx1	A	T	16: 97,454,147	Y235*	probably null	Het
Olfr1269	A	G	2: 90,118,669	*310Q	probably null	Het
Pamr1	T	G	2: 102,639,317	Y403D	probably damaging	Het
Panx2	A	G	15: 89,068,959	E551G	possibly damaging	Het
Patl2	A	G	2: 122,125,281	V258A	probably benign	Het
Ppm1m	A	G	9: 106,196,842	F255L	probably benign	Het
Prpf40a	G	T	2: 53,156,926	T266N	possibly damaging	Het
Psg18	T	A	7: 18,353,425	I103F	probably benign	Het
Rpl39-ps	A	G	15: 102,635,148		noncoding transcript	Het
Rps6kb1	A	T	11: 86,532,837	F106I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sardh	G	T	2: 27,239,698	T245K	possibly damaging	Het
Shprh	T	G	10: 11,212,330	I1619S	possibly damaging	Het
Skint1	G	A	4: 112,025,532	V258I	probably benign	Het
Slc27a5	T	C	7: 12,994,942	D331G	probably benign	Het
Slc29a2	A	G	19: 5,029,275	I309V	probably benign	Het
Slc30a5	C	T	13: 100,821,172	V130I	possibly damaging	Het
Slc4a3	C	A	1: 75,552,656	A531D	probably damaging	Het
Slc6a16	C	T	7: 45,261,248	T399I	probably benign	Het
Slitrk6	T	A	14: 110,750,097	H726L	probably benign	Het
Snx2	A	G	18: 53,210,712	K309R	probably damaging	Het
Speer4f2	T	A	5: 17,373,219	C4S	possibly damaging	Het
Tmem8b	G	A	4: 43,673,992	V208I	probably benign	Het
Vmn1r47	T	C	6: 90,022,213	L109P	probably damaging	Het
Vmn1r73	C	A	7: 11,756,449	Q65K	possibly damaging	Het
Vmn1r76	T	C	7: 11,930,684	Y166C	probably damaging	Het
Vmn2r2	T	C	3: 64,126,590	T504A	probably benign	Het
Wdr75	C	A	1: 45,812,164	A300E	probably benign	Het
Yars	A	G	4: 129,197,246	E149G	possibly damaging	Het
Zbtb18	T	C	1: 177,447,205	F35L	probably damaging	Het
Zfp366	A	G	13: 99,229,585	Y418C	probably damaging	Het

Other mutations in Sulf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Sulf1	APN	1	12820463	missense	probably damaging	0.99
IGL00788:Sulf1	APN	1	12848449	missense	probably damaging	0.99
IGL00845:Sulf1	APN	1	12796967	missense	probably damaging	1.00
IGL01606:Sulf1	APN	1	12836204	missense	possibly damaging	0.87
IGL01963:Sulf1	APN	1	12818507	missense	probably damaging	1.00
IGL01968:Sulf1	APN	1	12818451	missense	probably damaging	1.00
IGL02072:Sulf1	APN	1	12848208	missense	probably damaging	1.00
IGL02424:Sulf1	APN	1	12796840	missense	probably benign	0.28
IGL02519:Sulf1	APN	1	12838363	nonsense	probably null
IGL02601:Sulf1	APN	1	12786645	missense	probably damaging	1.00
IGL03066:Sulf1	APN	1	12807944	missense	probably damaging	0.99
IGL03200:Sulf1	APN	1	12786617	nonsense	probably null
PIT4480001:Sulf1	UTSW	1	12859413	missense	probably benign	0.01
PIT4519001:Sulf1	UTSW	1	12848171	missense	probably damaging	1.00
R0083:Sulf1	UTSW	1	12817417	missense	probably damaging	0.99
R0467:Sulf1	UTSW	1	12796920	missense	probably damaging	1.00
R0554:Sulf1	UTSW	1	12805194	missense	probably damaging	1.00
R0626:Sulf1	UTSW	1	12817492	splice site	probably null
R1083:Sulf1	UTSW	1	12836164	frame shift	probably null
R1084:Sulf1	UTSW	1	12836164	frame shift	probably null
R1498:Sulf1	UTSW	1	12848350	missense	probably damaging	1.00
R1523:Sulf1	UTSW	1	12817350	nonsense	probably null
R1854:Sulf1	UTSW	1	12838437	missense	probably benign	0.06
R1942:Sulf1	UTSW	1	12848173	missense	probably damaging	1.00
R1946:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R1998:Sulf1	UTSW	1	12858834	nonsense	probably null
R2034:Sulf1	UTSW	1	12820421	missense	probably damaging	1.00
R2068:Sulf1	UTSW	1	12840403	missense	probably damaging	1.00
R2113:Sulf1	UTSW	1	12848174	missense	probably damaging	0.99
R2277:Sulf1	UTSW	1	12796794	missense	probably benign	0.41
R3827:Sulf1	UTSW	1	12817432	missense	probably benign
R3874:Sulf1	UTSW	1	12817412	missense	probably damaging	1.00
R4488:Sulf1	UTSW	1	12786515	start gained	probably benign
R4619:Sulf1	UTSW	1	12786652	missense	probably damaging	1.00
R4743:Sulf1	UTSW	1	12836293	missense	probably benign	0.04
R4836:Sulf1	UTSW	1	12842686	missense	probably benign	0.02
R4918:Sulf1	UTSW	1	12818496	missense	probably damaging	1.00
R4958:Sulf1	UTSW	1	12796910	missense	probably benign	0.08
R5216:Sulf1	UTSW	1	12796874	missense	probably benign	0.28
R5225:Sulf1	UTSW	1	12841478	missense	probably benign
R5427:Sulf1	UTSW	1	12796912	missense	possibly damaging	0.84
R5909:Sulf1	UTSW	1	12858815	missense	possibly damaging	0.94
R5912:Sulf1	UTSW	1	12786752	unclassified	probably benign
R5966:Sulf1	UTSW	1	12859412	missense	probably benign	0.06
R6339:Sulf1	UTSW	1	12838440	missense	probably damaging	1.00
R6841:Sulf1	UTSW	1	12838434	missense	probably damaging	1.00
R6880:Sulf1	UTSW	1	12842755	missense	probably damaging	1.00
R7110:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R7255:Sulf1	UTSW	1	12859008	missense	probably benign	0.00
R7275:Sulf1	UTSW	1	12850965	splice site	probably null
R7386:Sulf1	UTSW	1	12838361	missense	probably benign	0.07
R7611:Sulf1	UTSW	1	12836243	missense	probably benign
R7732:Sulf1	UTSW	1	12842789	missense	probably benign	0.11
R7796:Sulf1	UTSW	1	12858820	missense	probably benign	0.27
R7898:Sulf1	UTSW	1	12805294	missense	probably damaging	1.00
R7984:Sulf1	UTSW	1	12859273	missense	probably benign	0.00
R8003:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R8684:Sulf1	UTSW	1	12796780	missense	probably benign	0.06
R8714:Sulf1	UTSW	1	12807917	missense	probably benign	0.07
R8723:Sulf1	UTSW	1	12786687	missense	probably damaging	1.00
R8988:Sulf1	UTSW	1	12836275	missense	probably benign
R9055:Sulf1	UTSW	1	12807963	missense	probably damaging	1.00
R9100:Sulf1	UTSW	1	12807894	missense	probably damaging	1.00
R9288:Sulf1	UTSW	1	12786603	missense	probably benign	0.09
R9358:Sulf1	UTSW	1	12820505	missense	probably damaging	1.00
R9387:Sulf1	UTSW	1	12838554	missense	probably benign	0.02
R9462:Sulf1	UTSW	1	12859235	missense	probably damaging	1.00
R9524:Sulf1	UTSW	1	12848398	missense	probably damaging	1.00
R9581:Sulf1	UTSW	1	12805254	missense	possibly damaging	0.66
R9664:Sulf1	UTSW	1	12820802	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGAACAGCGCTATCTAAATGAC -3'
(R):5'- TGTTGAGTCTCCTGGAACTTC -3'

Sequencing Primer
(F):5'- CAGCGCTATCTAAATGACTTATGG -3'
(R):5'- ATTACCCAGTGCAGTTCC -3'

Posted On

2016-09-06