Mutagenetix > Incidental Mutation

Incidental Mutation 'R5450:Arhgef4'

429247

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

043015-MU

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to G at 34807324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599]

AlphaFold

Q7TNR9

Predicted Effect

probably benign
Transcript: ENSMUST00000047664

SMART Domains

Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
RhoGEF	82	261	3.86e-56	SMART
PH	294	402	2.33e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159021

SMART Domains

Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
Pfam:RhoGEF	82	190	3.4e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159059

Predicted Effect

probably benign
Transcript: ENSMUST00000159747

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160855

SMART Domains

Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
Pfam:RhoGEF	82	187	1.2e-21	PFAM
low complexity region	194	211	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162599

SMART Domains

Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
SH3	194	249	3.73e-16	SMART
Pfam:RhoGEF	304	405	1.2e-25	PFAM
PH	438	546	2.33e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193040

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
AF067063	A	T	13: 119,828,363	V99E	probably damaging	Het
Atg14	T	C	14: 47,551,464	N144S	probably benign	Het
Cacna1h	A	T	17: 25,383,186	M1454K	probably damaging	Het
Catsperb	A	T	12: 101,446,068	H138L	possibly damaging	Het
Ccdc129	T	A	6: 55,968,811		probably null	Het
Cd200r2	T	A	16: 44,909,571	D159E	probably benign	Het
Cd79a	G	T	7: 24,899,262	G79C	probably damaging	Het
Ceacam20	A	G	7: 19,978,208	H38R	possibly damaging	Het
Cers1	T	C	8: 70,318,297	L119P	probably damaging	Het
Ces1f	C	A	8: 93,265,795	V343L	probably benign	Het
Ces3a	G	A	8: 105,057,918	G511S	possibly damaging	Het
Cyfip2	A	G	11: 46,284,252	C98R	probably benign	Het
Cyp2j11	C	A	4: 96,339,876	V169L	probably benign	Het
Cyp4f17	A	G	17: 32,528,886	T523A	probably benign	Het
Ddx31	T	C	2: 28,886,969	S567P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsg1b	A	C	18: 20,409,064	H876P	probably damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Eno4	T	C	19: 58,960,247	F393S	possibly damaging	Het
Eral1	C	T	11: 78,078,357	D106N	probably benign	Het
Esp18	G	T	17: 39,408,179	R23M	probably benign	Het
Fam184b	C	T	5: 45,539,801	V674I	probably benign	Het
Fbxw13	A	C	9: 109,184,157	N154K	probably benign	Het
Gtpbp6	A	G	5: 110,107,125	V130A	probably damaging	Het
Hc	T	C	2: 35,013,038	D1067G	possibly damaging	Het
Ighg1	A	T	12: 113,330,506	S6T	unknown	Het
Ikzf3	C	T	11: 98,467,086	R475H	probably damaging	Het
Kcmf1	A	T	6: 72,842,930	L311*	probably null	Het
Kmt2d	C	A	15: 98,855,086	E184D	probably damaging	Het
Lrguk	A	T	6: 34,071,061	I314F	probably damaging	Het
Maml2	A	C	9: 13,706,467	S370R	probably damaging	Het
Mroh1	C	A	15: 76,432,347		probably benign	Het
Mx1	A	T	16: 97,454,147	Y235*	probably null	Het
Olfr1269	A	G	2: 90,118,669	*310Q	probably null	Het
Pamr1	T	G	2: 102,639,317	Y403D	probably damaging	Het
Panx2	A	G	15: 89,068,959	E551G	possibly damaging	Het
Patl2	A	G	2: 122,125,281	V258A	probably benign	Het
Ppm1m	A	G	9: 106,196,842	F255L	probably benign	Het
Prpf40a	G	T	2: 53,156,926	T266N	possibly damaging	Het
Psg18	T	A	7: 18,353,425	I103F	probably benign	Het
Rpl39-ps	A	G	15: 102,635,148		noncoding transcript	Het
Rps6kb1	A	T	11: 86,532,837	F106I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sardh	G	T	2: 27,239,698	T245K	possibly damaging	Het
Shprh	T	G	10: 11,212,330	I1619S	possibly damaging	Het
Skint1	G	A	4: 112,025,532	V258I	probably benign	Het
Slc27a5	T	C	7: 12,994,942	D331G	probably benign	Het
Slc29a2	A	G	19: 5,029,275	I309V	probably benign	Het
Slc30a5	C	T	13: 100,821,172	V130I	possibly damaging	Het
Slc4a3	C	A	1: 75,552,656	A531D	probably damaging	Het
Slc6a16	C	T	7: 45,261,248	T399I	probably benign	Het
Slitrk6	T	A	14: 110,750,097	H726L	probably benign	Het
Snx2	A	G	18: 53,210,712	K309R	probably damaging	Het
Speer4f2	T	A	5: 17,373,219	C4S	possibly damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Tmem8b	G	A	4: 43,673,992	V208I	probably benign	Het
Vmn1r47	T	C	6: 90,022,213	L109P	probably damaging	Het
Vmn1r73	C	A	7: 11,756,449	Q65K	possibly damaging	Het
Vmn1r76	T	C	7: 11,930,684	Y166C	probably damaging	Het
Vmn2r2	T	C	3: 64,126,590	T504A	probably benign	Het
Wdr75	C	A	1: 45,812,164	A300E	probably benign	Het
Yars	A	G	4: 129,197,246	E149G	possibly damaging	Het
Zbtb18	T	C	1: 177,447,205	F35L	probably damaging	Het
Zfp366	A	G	13: 99,229,585	Y418C	probably damaging	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
R9046:Arhgef4	UTSW	1	34811765	missense	possibly damaging	0.92
R9077:Arhgef4	UTSW	1	34721743	missense	unknown
R9209:Arhgef4	UTSW	1	34725160	critical splice donor site	probably null
R9209:Arhgef4	UTSW	1	34810495	missense	probably benign
R9355:Arhgef4	UTSW	1	34810549	missense	probably benign	0.02
R9489:Arhgef4	UTSW	1	34722664	missense	unknown
R9509:Arhgef4	UTSW	1	34723691	missense	unknown
R9605:Arhgef4	UTSW	1	34722664	missense	unknown
R9665:Arhgef4	UTSW	1	34810437	missense	probably benign
R9675:Arhgef4	UTSW	1	34806027	missense	probably benign
R9790:Arhgef4	UTSW	1	34793364	critical splice donor site	probably null
R9791:Arhgef4	UTSW	1	34793364	critical splice donor site	probably null
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGAAGCTCAGCAAGTACGTG -3'
(R):5'- AAGTACAGTAGCCCTCCTTTCC -3'

Sequencing Primer
(F):5'- AGTACGTGTACTTCTTCGAGGCC -3'
(R):5'- TCCTGCATAACTTCCAGGTATAACAG -3'

Posted On

2016-09-06