Incidental Mutation 'R5450:Slc4a3'
ID 429249
Institutional Source Beutler Lab
Gene Symbol Slc4a3
Ensembl Gene ENSMUSG00000006576
Gene Name solute carrier family 4 (anion exchanger), member 3
Synonyms Ae3, A930038D23Rik
MMRRC Submission 043015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5450 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75522688-75536075 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 75529300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 531 (A531D)
Ref Sequence ENSEMBL: ENSMUSP00000116747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027415] [ENSMUST00000124341] [ENSMUST00000138814] [ENSMUST00000150142] [ENSMUST00000154101]
AlphaFold P16283
Predicted Effect unknown
Transcript: ENSMUST00000027415
AA Change: S539R
SMART Domains Protein: ENSMUSP00000027415
Gene: ENSMUSG00000006576
AA Change: S539R

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 500 7.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124341
AA Change: A531D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116747
Gene: ENSMUSG00000006576
AA Change: A531D

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 618 2.9e-106 PFAM
low complexity region 629 639 N/A INTRINSIC
Pfam:HCO3_cotransp 674 1156 3.6e-203 PFAM
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132110
SMART Domains Protein: ENSMUSP00000119942
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
SCOP:d1hynp_ 4 72 9e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132612
Predicted Effect probably benign
Transcript: ENSMUST00000138814
SMART Domains Protein: ENSMUSP00000122749
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142257
Predicted Effect probably benign
Transcript: ENSMUST00000145258
SMART Domains Protein: ENSMUSP00000119860
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:Band_3_cyto 50 193 4.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145516
Predicted Effect probably benign
Transcript: ENSMUST00000150142
SMART Domains Protein: ENSMUSP00000120078
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154101
SMART Domains Protein: ENSMUSP00000116488
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:Band_3_cyto 152 227 2e-32 PFAM
Meta Mutation Damage Score 0.9433 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane anion exchange protein. The encoded protein has been found in brain, heart, kidney, small intestine, and lung. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for one knock-out allele show inner retina defects including selective ERG b-wave depression, optic nerve and retinal vessel anomalies, sheathing of retinal vessels and late onset photoreceptor death. Homozygotes for another knock-out allele are more sensitive to seizure-inducing agents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Arhgef4 T G 1: 34,846,405 (GRCm39) probably benign Het
Atg14 T C 14: 47,788,921 (GRCm39) N144S probably benign Het
Cacna1h A T 17: 25,602,160 (GRCm39) M1454K probably damaging Het
Catsperb A T 12: 101,412,327 (GRCm39) H138L possibly damaging Het
Cd200r2 T A 16: 44,729,934 (GRCm39) D159E probably benign Het
Cd79a G T 7: 24,598,687 (GRCm39) G79C probably damaging Het
Ceacam20 A G 7: 19,712,133 (GRCm39) H38R possibly damaging Het
Cers1 T C 8: 70,770,947 (GRCm39) L119P probably damaging Het
Ces1f C A 8: 93,992,423 (GRCm39) V343L probably benign Het
Ces3a G A 8: 105,784,550 (GRCm39) G511S possibly damaging Het
Cyfip2 A G 11: 46,175,079 (GRCm39) C98R probably benign Het
Cyp2j11 C A 4: 96,228,113 (GRCm39) V169L probably benign Het
Cyp4f17 A G 17: 32,747,860 (GRCm39) T523A probably benign Het
Ddx31 T C 2: 28,776,981 (GRCm39) S567P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dsg1b A C 18: 20,542,121 (GRCm39) H876P probably damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Eno4 T C 19: 58,948,679 (GRCm39) F393S possibly damaging Het
Eral1 C T 11: 77,969,183 (GRCm39) D106N probably benign Het
Esp18 G T 17: 39,719,070 (GRCm39) R23M probably benign Het
Fam184b C T 5: 45,697,143 (GRCm39) V674I probably benign Het
Fbxw13 A C 9: 109,013,225 (GRCm39) N154K probably benign Het
Gtpbp6 A G 5: 110,254,991 (GRCm39) V130A probably damaging Het
Hc T C 2: 34,903,050 (GRCm39) D1067G possibly damaging Het
Ighg1 A T 12: 113,294,126 (GRCm39) S6T unknown Het
Ikzf3 C T 11: 98,357,912 (GRCm39) R475H probably damaging Het
Itprid1 T A 6: 55,945,796 (GRCm39) probably null Het
Kcmf1 A T 6: 72,819,913 (GRCm39) L311* probably null Het
Kmt2d C A 15: 98,752,967 (GRCm39) E184D probably damaging Het
Lrguk A T 6: 34,047,996 (GRCm39) I314F probably damaging Het
Maml2 A C 9: 13,617,763 (GRCm39) S370R probably damaging Het
Mroh1 C A 15: 76,316,547 (GRCm39) probably benign Het
Mx1 A T 16: 97,255,347 (GRCm39) Y235* probably null Het
Or4x6 A G 2: 89,949,013 (GRCm39) *310Q probably null Het
Pamr1 T G 2: 102,469,662 (GRCm39) Y403D probably damaging Het
Panx2 A G 15: 88,953,162 (GRCm39) E551G possibly damaging Het
Patl2 A G 2: 121,955,762 (GRCm39) V258A probably benign Het
Ppm1m A G 9: 106,074,041 (GRCm39) F255L probably benign Het
Prpf40a G T 2: 53,046,938 (GRCm39) T266N possibly damaging Het
Psg18 T A 7: 18,087,350 (GRCm39) I103F probably benign Het
Rpl39-ps A G 15: 102,543,583 (GRCm39) noncoding transcript Het
Rps6kb1 A T 11: 86,423,663 (GRCm39) F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Sardh G T 2: 27,129,710 (GRCm39) T245K possibly damaging Het
Shprh T G 10: 11,088,074 (GRCm39) I1619S possibly damaging Het
Skint1 G A 4: 111,882,729 (GRCm39) V258I probably benign Het
Slc27a5 T C 7: 12,728,869 (GRCm39) D331G probably benign Het
Slc29a2 A G 19: 5,079,303 (GRCm39) I309V probably benign Het
Slc30a5 C T 13: 100,957,680 (GRCm39) V130I possibly damaging Het
Slc6a16 C T 7: 44,910,672 (GRCm39) T399I probably benign Het
Slitrk6 T A 14: 110,987,529 (GRCm39) H726L probably benign Het
Snx2 A G 18: 53,343,784 (GRCm39) K309R probably damaging Het
Speer4f2 T A 5: 17,578,217 (GRCm39) C4S possibly damaging Het
Sulf1 T C 1: 12,867,131 (GRCm39) V105A probably benign Het
Tcstv7a A T 13: 120,289,899 (GRCm39) V99E probably damaging Het
Tmem8b G A 4: 43,673,992 (GRCm39) V208I probably benign Het
Vmn1r47 T C 6: 89,999,195 (GRCm39) L109P probably damaging Het
Vmn1r73 C A 7: 11,490,376 (GRCm39) Q65K possibly damaging Het
Vmn1r76 T C 7: 11,664,611 (GRCm39) Y166C probably damaging Het
Vmn2r2 T C 3: 64,034,011 (GRCm39) T504A probably benign Het
Wdr75 C A 1: 45,851,324 (GRCm39) A300E probably benign Het
Yars1 A G 4: 129,091,039 (GRCm39) E149G possibly damaging Het
Zbtb18 T C 1: 177,274,771 (GRCm39) F35L probably damaging Het
Zfp366 A G 13: 99,366,093 (GRCm39) Y418C probably damaging Het
Other mutations in Slc4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Slc4a3 APN 1 75,531,727 (GRCm39) missense probably damaging 1.00
IGL00979:Slc4a3 APN 1 75,530,891 (GRCm39) missense probably damaging 1.00
IGL01488:Slc4a3 APN 1 75,525,520 (GRCm39) missense probably benign 0.45
IGL01567:Slc4a3 APN 1 75,527,526 (GRCm39) missense probably damaging 1.00
IGL03090:Slc4a3 APN 1 75,531,661 (GRCm39) missense probably benign 0.00
IGL03135:Slc4a3 APN 1 75,524,579 (GRCm39) unclassified probably benign
R0004:Slc4a3 UTSW 1 75,533,653 (GRCm39) unclassified probably benign
R0479:Slc4a3 UTSW 1 75,528,472 (GRCm39) unclassified probably benign
R0507:Slc4a3 UTSW 1 75,532,725 (GRCm39) missense probably damaging 1.00
R0591:Slc4a3 UTSW 1 75,525,665 (GRCm39) missense probably damaging 1.00
R0742:Slc4a3 UTSW 1 75,532,725 (GRCm39) missense probably damaging 1.00
R1577:Slc4a3 UTSW 1 75,527,535 (GRCm39) missense probably damaging 1.00
R1794:Slc4a3 UTSW 1 75,533,952 (GRCm39) missense probably damaging 0.99
R1804:Slc4a3 UTSW 1 75,528,361 (GRCm39) missense probably damaging 1.00
R1911:Slc4a3 UTSW 1 75,530,367 (GRCm39) missense probably damaging 1.00
R1974:Slc4a3 UTSW 1 75,528,835 (GRCm39) nonsense probably null
R2696:Slc4a3 UTSW 1 75,532,119 (GRCm39) missense possibly damaging 0.46
R2995:Slc4a3 UTSW 1 75,529,306 (GRCm39) nonsense probably null
R3962:Slc4a3 UTSW 1 75,533,398 (GRCm39) missense probably damaging 0.99
R4025:Slc4a3 UTSW 1 75,525,685 (GRCm39) missense probably damaging 1.00
R4824:Slc4a3 UTSW 1 75,527,267 (GRCm39) missense possibly damaging 0.54
R4858:Slc4a3 UTSW 1 75,531,729 (GRCm39) missense probably damaging 1.00
R5075:Slc4a3 UTSW 1 75,534,012 (GRCm39) missense probably damaging 1.00
R5636:Slc4a3 UTSW 1 75,530,860 (GRCm39) missense possibly damaging 0.82
R5728:Slc4a3 UTSW 1 75,526,484 (GRCm39) missense probably benign 0.05
R5921:Slc4a3 UTSW 1 75,534,088 (GRCm39) critical splice donor site probably null
R5969:Slc4a3 UTSW 1 75,526,623 (GRCm39) missense probably damaging 0.98
R6272:Slc4a3 UTSW 1 75,531,341 (GRCm39) critical splice donor site probably null
R6749:Slc4a3 UTSW 1 75,531,182 (GRCm39) nonsense probably null
R6788:Slc4a3 UTSW 1 75,527,959 (GRCm39) missense probably damaging 1.00
R7308:Slc4a3 UTSW 1 75,534,006 (GRCm39) missense probably benign 0.00
R7487:Slc4a3 UTSW 1 75,530,021 (GRCm39) missense probably benign 0.05
R7673:Slc4a3 UTSW 1 75,533,995 (GRCm39) missense probably damaging 1.00
R7968:Slc4a3 UTSW 1 75,528,007 (GRCm39) missense probably benign 0.00
R8004:Slc4a3 UTSW 1 75,525,711 (GRCm39) critical splice donor site probably null
R8084:Slc4a3 UTSW 1 75,532,589 (GRCm39) missense probably benign 0.25
R8109:Slc4a3 UTSW 1 75,528,448 (GRCm39) missense possibly damaging 0.88
R8221:Slc4a3 UTSW 1 75,528,810 (GRCm39) missense probably benign 0.02
R8358:Slc4a3 UTSW 1 75,530,359 (GRCm39) missense probably damaging 1.00
R8520:Slc4a3 UTSW 1 75,526,506 (GRCm39) missense probably benign
R8759:Slc4a3 UTSW 1 75,531,282 (GRCm39) missense probably damaging 1.00
R8988:Slc4a3 UTSW 1 75,527,957 (GRCm39) missense probably damaging 1.00
R9515:Slc4a3 UTSW 1 75,533,612 (GRCm39) missense probably damaging 0.98
R9758:Slc4a3 UTSW 1 75,534,319 (GRCm39) missense probably damaging 1.00
Z1176:Slc4a3 UTSW 1 75,530,879 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAAGCGAACAGGGTACTTG -3'
(R):5'- ACTCCAGAGACAGACAGCTAGG -3'

Sequencing Primer
(F):5'- CGAACAGGGTACTTGAGATCTG -3'
(R):5'- TAAAGAAGCCATCCCAGGTTACAG -3'
Posted On 2016-09-06