Incidental Mutation 'R5450:Prpf40a'
ID429255
Institutional Source Beutler Lab
Gene Symbol Prpf40a
Ensembl Gene ENSMUSG00000061136
Gene Namepre-mRNA processing factor 40A
SynonymsFnbp3, FBP11, 2810012K09Rik
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location53134704-53191284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53156926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 266 (T266N)
Ref Sequence ENSEMBL: ENSMUSP00000075655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076313] [ENSMUST00000125243] [ENSMUST00000209364] [ENSMUST00000209508] [ENSMUST00000210789] [ENSMUST00000211102] [ENSMUST00000211712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076313
AA Change: T266N

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136
AA Change: T266N

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125243
SMART Domains Protein: ENSMUSP00000117406
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 35 82 N/A INTRINSIC
WW 99 131 7.54e-13 SMART
WW 140 172 1.57e-10 SMART
low complexity region 230 252 N/A INTRINSIC
FF 347 401 1.32e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209364
AA Change: T239N

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000209508
Predicted Effect possibly damaging
Transcript: ENSMUST00000210789
AA Change: T224N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000211102
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Prpf40a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Prpf40a APN 2 53150688 missense probably benign 0.00
IGL00533:Prpf40a APN 2 53145343 missense probably damaging 1.00
IGL01099:Prpf40a APN 2 53141835 missense probably benign 0.00
IGL02039:Prpf40a APN 2 53144803 missense probably damaging 1.00
IGL02608:Prpf40a APN 2 53146153 missense probably damaging 0.97
I1329:Prpf40a UTSW 2 53176395 missense probably benign 0.01
R0284:Prpf40a UTSW 2 53150647 missense probably damaging 1.00
R0401:Prpf40a UTSW 2 53159313 missense probably damaging 0.99
R0544:Prpf40a UTSW 2 53141651 unclassified probably benign
R0582:Prpf40a UTSW 2 53145692 missense probably damaging 1.00
R1533:Prpf40a UTSW 2 53145840 missense probably damaging 1.00
R2057:Prpf40a UTSW 2 53144839 missense probably damaging 1.00
R4274:Prpf40a UTSW 2 53146172 missense probably damaging 1.00
R4604:Prpf40a UTSW 2 53142023 missense probably damaging 0.99
R4814:Prpf40a UTSW 2 53190020 missense probably damaging 1.00
R4976:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5119:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5378:Prpf40a UTSW 2 53145876 missense probably damaging 1.00
R5448:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5449:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5500:Prpf40a UTSW 2 53145284 missense probably benign 0.03
R5637:Prpf40a UTSW 2 53156734 missense possibly damaging 0.59
R6052:Prpf40a UTSW 2 53159281 missense probably benign 0.41
R6149:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6150:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6151:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6162:Prpf40a UTSW 2 53159305 missense probably benign 0.01
R6199:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6200:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6207:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6254:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6266:Prpf40a UTSW 2 53156627 missense probably benign 0.17
R6394:Prpf40a UTSW 2 53144878 missense probably damaging 1.00
R6603:Prpf40a UTSW 2 53152963 missense probably damaging 0.96
R6606:Prpf40a UTSW 2 53151751 missense probably damaging 0.99
R6641:Prpf40a UTSW 2 53141626 unclassified probably benign
R6929:Prpf40a UTSW 2 53144863 missense possibly damaging 0.95
R7158:Prpf40a UTSW 2 53152553 missense probably damaging 0.99
R7401:Prpf40a UTSW 2 53156947 missense probably benign 0.01
R7675:Prpf40a UTSW 2 53145636 missense possibly damaging 0.89
R7750:Prpf40a UTSW 2 53151745 missense probably damaging 1.00
R7893:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R8027:Prpf40a UTSW 2 53191138 missense probably benign 0.01
X0060:Prpf40a UTSW 2 53145664 missense probably damaging 0.96
Z1176:Prpf40a UTSW 2 53144875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTCAGTTGATACAGTTACTG -3'
(R):5'- GTATTGAAATGACCAGTTCTCGTG -3'

Sequencing Primer
(F):5'- TGGAACACTTCCCACAGT -3'
(R):5'- GAAATGACCAGTTCTCGTGTTCTC -3'
Posted On2016-09-06