Incidental Mutation 'R5450:Fam184b'
ID 429264
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Name family with sequence similarity 184, member B
Synonyms 9630031F12Rik
MMRRC Submission 043015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5450 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 45687047-45796843 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45697143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 674 (V674I)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
AlphaFold Q0KK56
Predicted Effect probably benign
Transcript: ENSMUST00000016023
AA Change: V674I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: V674I

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198680
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Arhgef4 T G 1: 34,846,405 (GRCm39) probably benign Het
Atg14 T C 14: 47,788,921 (GRCm39) N144S probably benign Het
Cacna1h A T 17: 25,602,160 (GRCm39) M1454K probably damaging Het
Catsperb A T 12: 101,412,327 (GRCm39) H138L possibly damaging Het
Cd200r2 T A 16: 44,729,934 (GRCm39) D159E probably benign Het
Cd79a G T 7: 24,598,687 (GRCm39) G79C probably damaging Het
Ceacam20 A G 7: 19,712,133 (GRCm39) H38R possibly damaging Het
Cers1 T C 8: 70,770,947 (GRCm39) L119P probably damaging Het
Ces1f C A 8: 93,992,423 (GRCm39) V343L probably benign Het
Ces3a G A 8: 105,784,550 (GRCm39) G511S possibly damaging Het
Cyfip2 A G 11: 46,175,079 (GRCm39) C98R probably benign Het
Cyp2j11 C A 4: 96,228,113 (GRCm39) V169L probably benign Het
Cyp4f17 A G 17: 32,747,860 (GRCm39) T523A probably benign Het
Ddx31 T C 2: 28,776,981 (GRCm39) S567P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dsg1b A C 18: 20,542,121 (GRCm39) H876P probably damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Eno4 T C 19: 58,948,679 (GRCm39) F393S possibly damaging Het
Eral1 C T 11: 77,969,183 (GRCm39) D106N probably benign Het
Esp18 G T 17: 39,719,070 (GRCm39) R23M probably benign Het
Fbxw13 A C 9: 109,013,225 (GRCm39) N154K probably benign Het
Gtpbp6 A G 5: 110,254,991 (GRCm39) V130A probably damaging Het
Hc T C 2: 34,903,050 (GRCm39) D1067G possibly damaging Het
Ighg1 A T 12: 113,294,126 (GRCm39) S6T unknown Het
Ikzf3 C T 11: 98,357,912 (GRCm39) R475H probably damaging Het
Itprid1 T A 6: 55,945,796 (GRCm39) probably null Het
Kcmf1 A T 6: 72,819,913 (GRCm39) L311* probably null Het
Kmt2d C A 15: 98,752,967 (GRCm39) E184D probably damaging Het
Lrguk A T 6: 34,047,996 (GRCm39) I314F probably damaging Het
Maml2 A C 9: 13,617,763 (GRCm39) S370R probably damaging Het
Mroh1 C A 15: 76,316,547 (GRCm39) probably benign Het
Mx1 A T 16: 97,255,347 (GRCm39) Y235* probably null Het
Or4x6 A G 2: 89,949,013 (GRCm39) *310Q probably null Het
Pamr1 T G 2: 102,469,662 (GRCm39) Y403D probably damaging Het
Panx2 A G 15: 88,953,162 (GRCm39) E551G possibly damaging Het
Patl2 A G 2: 121,955,762 (GRCm39) V258A probably benign Het
Ppm1m A G 9: 106,074,041 (GRCm39) F255L probably benign Het
Prpf40a G T 2: 53,046,938 (GRCm39) T266N possibly damaging Het
Psg18 T A 7: 18,087,350 (GRCm39) I103F probably benign Het
Rpl39-ps A G 15: 102,543,583 (GRCm39) noncoding transcript Het
Rps6kb1 A T 11: 86,423,663 (GRCm39) F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Sardh G T 2: 27,129,710 (GRCm39) T245K possibly damaging Het
Shprh T G 10: 11,088,074 (GRCm39) I1619S possibly damaging Het
Skint1 G A 4: 111,882,729 (GRCm39) V258I probably benign Het
Slc27a5 T C 7: 12,728,869 (GRCm39) D331G probably benign Het
Slc29a2 A G 19: 5,079,303 (GRCm39) I309V probably benign Het
Slc30a5 C T 13: 100,957,680 (GRCm39) V130I possibly damaging Het
Slc4a3 C A 1: 75,529,300 (GRCm39) A531D probably damaging Het
Slc6a16 C T 7: 44,910,672 (GRCm39) T399I probably benign Het
Slitrk6 T A 14: 110,987,529 (GRCm39) H726L probably benign Het
Snx2 A G 18: 53,343,784 (GRCm39) K309R probably damaging Het
Speer4f2 T A 5: 17,578,217 (GRCm39) C4S possibly damaging Het
Sulf1 T C 1: 12,867,131 (GRCm39) V105A probably benign Het
Tcstv7a A T 13: 120,289,899 (GRCm39) V99E probably damaging Het
Tmem8b G A 4: 43,673,992 (GRCm39) V208I probably benign Het
Vmn1r47 T C 6: 89,999,195 (GRCm39) L109P probably damaging Het
Vmn1r73 C A 7: 11,490,376 (GRCm39) Q65K possibly damaging Het
Vmn1r76 T C 7: 11,664,611 (GRCm39) Y166C probably damaging Het
Vmn2r2 T C 3: 64,034,011 (GRCm39) T504A probably benign Het
Wdr75 C A 1: 45,851,324 (GRCm39) A300E probably benign Het
Yars1 A G 4: 129,091,039 (GRCm39) E149G possibly damaging Het
Zbtb18 T C 1: 177,274,771 (GRCm39) F35L probably damaging Het
Zfp366 A G 13: 99,366,093 (GRCm39) Y418C probably damaging Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45,697,091 (GRCm39) missense probably benign 0.17
IGL00781:Fam184b APN 5 45,712,534 (GRCm39) splice site probably null
IGL01636:Fam184b APN 5 45,741,637 (GRCm39) missense probably benign 0.00
IGL02008:Fam184b APN 5 45,690,165 (GRCm39) missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45,796,493 (GRCm39) missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45,690,157 (GRCm39) nonsense probably null
IGL02192:Fam184b APN 5 45,695,062 (GRCm39) missense probably benign 0.00
IGL02478:Fam184b APN 5 45,695,039 (GRCm39) missense probably damaging 0.99
IGL03368:Fam184b APN 5 45,689,166 (GRCm39) missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45,712,536 (GRCm39) splice site probably benign
R0129:Fam184b UTSW 5 45,690,120 (GRCm39) missense probably damaging 1.00
R0420:Fam184b UTSW 5 45,741,854 (GRCm39) missense probably damaging 1.00
R0647:Fam184b UTSW 5 45,741,932 (GRCm39) missense probably benign
R1215:Fam184b UTSW 5 45,741,520 (GRCm39) missense probably damaging 1.00
R1374:Fam184b UTSW 5 45,712,485 (GRCm39) missense probably benign
R1466:Fam184b UTSW 5 45,737,851 (GRCm39) splice site probably benign
R1773:Fam184b UTSW 5 45,741,676 (GRCm39) missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45,689,231 (GRCm39) missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45,740,157 (GRCm39) missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45,740,157 (GRCm39) missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45,697,106 (GRCm39) missense probably benign 0.00
R4375:Fam184b UTSW 5 45,699,685 (GRCm39) missense probably benign
R4674:Fam184b UTSW 5 45,740,230 (GRCm39) nonsense probably null
R4942:Fam184b UTSW 5 45,730,649 (GRCm39) missense probably damaging 0.97
R5021:Fam184b UTSW 5 45,730,604 (GRCm39) missense probably benign 0.01
R5731:Fam184b UTSW 5 45,710,471 (GRCm39) missense probably benign 0.00
R5858:Fam184b UTSW 5 45,796,461 (GRCm39) missense probably damaging 0.99
R6032:Fam184b UTSW 5 45,740,238 (GRCm39) missense probably benign 0.01
R6032:Fam184b UTSW 5 45,740,238 (GRCm39) missense probably benign 0.01
R6060:Fam184b UTSW 5 45,710,489 (GRCm39) missense probably damaging 0.99
R6088:Fam184b UTSW 5 45,741,354 (GRCm39) missense probably damaging 1.00
R6416:Fam184b UTSW 5 45,694,995 (GRCm39) missense probably benign 0.04
R6932:Fam184b UTSW 5 45,690,243 (GRCm39) splice site probably null
R6956:Fam184b UTSW 5 45,688,099 (GRCm39) missense probably damaging 0.97
R6965:Fam184b UTSW 5 45,712,477 (GRCm39) missense probably benign
R7229:Fam184b UTSW 5 45,741,517 (GRCm39) missense probably damaging 1.00
R7303:Fam184b UTSW 5 45,699,568 (GRCm39) critical splice donor site probably null
R7429:Fam184b UTSW 5 45,698,230 (GRCm39) missense probably benign
R7522:Fam184b UTSW 5 45,688,093 (GRCm39) missense probably damaging 1.00
R7541:Fam184b UTSW 5 45,699,574 (GRCm39) missense probably damaging 0.99
R7942:Fam184b UTSW 5 45,741,595 (GRCm39) missense probably benign 0.16
R8172:Fam184b UTSW 5 45,741,709 (GRCm39) missense possibly damaging 0.86
R9470:Fam184b UTSW 5 45,741,854 (GRCm39) missense probably damaging 1.00
R9649:Fam184b UTSW 5 45,796,484 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGCTCCAACCAATGATG -3'
(R):5'- TGGAACGCCTCTAGAAAGGTC -3'

Sequencing Primer
(F):5'- AGGCAGGAATCAATGGAAGCTG -3'
(R):5'- CGCCTCTAGAAAGGTCAGGAAG -3'
Posted On 2016-09-06