Incidental Mutation 'R5450:Shprh'
ID 429288
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 043015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5450 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 11088074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 1619 (I1619S)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541]
AlphaFold Q7TPQ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000044053
AA Change: I1619S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: I1619S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161910
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Arhgef4 T G 1: 34,846,405 (GRCm39) probably benign Het
Atg14 T C 14: 47,788,921 (GRCm39) N144S probably benign Het
Cacna1h A T 17: 25,602,160 (GRCm39) M1454K probably damaging Het
Catsperb A T 12: 101,412,327 (GRCm39) H138L possibly damaging Het
Cd200r2 T A 16: 44,729,934 (GRCm39) D159E probably benign Het
Cd79a G T 7: 24,598,687 (GRCm39) G79C probably damaging Het
Ceacam20 A G 7: 19,712,133 (GRCm39) H38R possibly damaging Het
Cers1 T C 8: 70,770,947 (GRCm39) L119P probably damaging Het
Ces1f C A 8: 93,992,423 (GRCm39) V343L probably benign Het
Ces3a G A 8: 105,784,550 (GRCm39) G511S possibly damaging Het
Cyfip2 A G 11: 46,175,079 (GRCm39) C98R probably benign Het
Cyp2j11 C A 4: 96,228,113 (GRCm39) V169L probably benign Het
Cyp4f17 A G 17: 32,747,860 (GRCm39) T523A probably benign Het
Ddx31 T C 2: 28,776,981 (GRCm39) S567P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dsg1b A C 18: 20,542,121 (GRCm39) H876P probably damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Eno4 T C 19: 58,948,679 (GRCm39) F393S possibly damaging Het
Eral1 C T 11: 77,969,183 (GRCm39) D106N probably benign Het
Esp18 G T 17: 39,719,070 (GRCm39) R23M probably benign Het
Fam184b C T 5: 45,697,143 (GRCm39) V674I probably benign Het
Fbxw13 A C 9: 109,013,225 (GRCm39) N154K probably benign Het
Gtpbp6 A G 5: 110,254,991 (GRCm39) V130A probably damaging Het
Hc T C 2: 34,903,050 (GRCm39) D1067G possibly damaging Het
Ighg1 A T 12: 113,294,126 (GRCm39) S6T unknown Het
Ikzf3 C T 11: 98,357,912 (GRCm39) R475H probably damaging Het
Itprid1 T A 6: 55,945,796 (GRCm39) probably null Het
Kcmf1 A T 6: 72,819,913 (GRCm39) L311* probably null Het
Kmt2d C A 15: 98,752,967 (GRCm39) E184D probably damaging Het
Lrguk A T 6: 34,047,996 (GRCm39) I314F probably damaging Het
Maml2 A C 9: 13,617,763 (GRCm39) S370R probably damaging Het
Mroh1 C A 15: 76,316,547 (GRCm39) probably benign Het
Mx1 A T 16: 97,255,347 (GRCm39) Y235* probably null Het
Or4x6 A G 2: 89,949,013 (GRCm39) *310Q probably null Het
Pamr1 T G 2: 102,469,662 (GRCm39) Y403D probably damaging Het
Panx2 A G 15: 88,953,162 (GRCm39) E551G possibly damaging Het
Patl2 A G 2: 121,955,762 (GRCm39) V258A probably benign Het
Ppm1m A G 9: 106,074,041 (GRCm39) F255L probably benign Het
Prpf40a G T 2: 53,046,938 (GRCm39) T266N possibly damaging Het
Psg18 T A 7: 18,087,350 (GRCm39) I103F probably benign Het
Rpl39-ps A G 15: 102,543,583 (GRCm39) noncoding transcript Het
Rps6kb1 A T 11: 86,423,663 (GRCm39) F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Sardh G T 2: 27,129,710 (GRCm39) T245K possibly damaging Het
Skint1 G A 4: 111,882,729 (GRCm39) V258I probably benign Het
Slc27a5 T C 7: 12,728,869 (GRCm39) D331G probably benign Het
Slc29a2 A G 19: 5,079,303 (GRCm39) I309V probably benign Het
Slc30a5 C T 13: 100,957,680 (GRCm39) V130I possibly damaging Het
Slc4a3 C A 1: 75,529,300 (GRCm39) A531D probably damaging Het
Slc6a16 C T 7: 44,910,672 (GRCm39) T399I probably benign Het
Slitrk6 T A 14: 110,987,529 (GRCm39) H726L probably benign Het
Snx2 A G 18: 53,343,784 (GRCm39) K309R probably damaging Het
Speer4f2 T A 5: 17,578,217 (GRCm39) C4S possibly damaging Het
Sulf1 T C 1: 12,867,131 (GRCm39) V105A probably benign Het
Tcstv7a A T 13: 120,289,899 (GRCm39) V99E probably damaging Het
Tmem8b G A 4: 43,673,992 (GRCm39) V208I probably benign Het
Vmn1r47 T C 6: 89,999,195 (GRCm39) L109P probably damaging Het
Vmn1r73 C A 7: 11,490,376 (GRCm39) Q65K possibly damaging Het
Vmn1r76 T C 7: 11,664,611 (GRCm39) Y166C probably damaging Het
Vmn2r2 T C 3: 64,034,011 (GRCm39) T504A probably benign Het
Wdr75 C A 1: 45,851,324 (GRCm39) A300E probably benign Het
Yars1 A G 4: 129,091,039 (GRCm39) E149G possibly damaging Het
Zbtb18 T C 1: 177,274,771 (GRCm39) F35L probably damaging Het
Zfp366 A G 13: 99,366,093 (GRCm39) Y418C probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAGATCACATTGGCGGTATG -3'
(R):5'- GTCCAAAACATTAATTGGGACATGC -3'

Sequencing Primer
(F):5'- CACATTGGCGGTATGTGCTG -3'
(R):5'- GGACATGCTTTGGATAACATGC -3'
Posted On 2016-09-06