Incidental Mutation 'R5450:Eral1'
ID429292
Institutional Source Beutler Lab
Gene Symbol Eral1
Ensembl Gene ENSMUSG00000020832
Gene NameEra (G-protein)-like 1 (E. coli)
Synonyms2610524P08Rik, 9130407C09Rik, MERA-W, MERA-S
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78073376-78080383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78078357 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 106 (D106N)
Ref Sequence ENSEMBL: ENSMUSP00000021183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021183]
Predicted Effect probably benign
Transcript: ENSMUST00000021183
AA Change: D106N

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021183
Gene: ENSMUSG00000020832
AA Change: D106N

DomainStartEndE-ValueType
low complexity region 79 92 N/A INTRINSIC
Pfam:AIG1 114 249 2.2e-11 PFAM
Pfam:FeoB_N 114 260 5e-10 PFAM
Pfam:MMR_HSR1 115 237 4e-21 PFAM
Pfam:Dynamin_N 116 162 1.6e-6 PFAM
Pfam:KH_2 363 437 6.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139731
Meta Mutation Damage Score 0.2556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase that localizes to the mitochondrion. The encoded protein binds to the 3' terminal stem loop of 12S mitochondrial rRNA and is required for proper assembly of the 28S small mitochondrial ribosomal subunit. Deletion of this gene has been shown to cause mitochondrial dysfunction, growth retardation, and apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Eral1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Eral1 APN 11 78075732 missense probably damaging 1.00
IGL01643:Eral1 APN 11 78074278 critical splice donor site probably null
IGL02240:Eral1 APN 11 78077861 nonsense probably null
IGL03085:Eral1 APN 11 78078267 missense probably damaging 1.00
K3955:Eral1 UTSW 11 78076021 missense probably damaging 1.00
P0038:Eral1 UTSW 11 78076021 missense probably damaging 1.00
R0240:Eral1 UTSW 11 78076058 splice site probably benign
R1084:Eral1 UTSW 11 78074498 missense probably damaging 0.96
R1563:Eral1 UTSW 11 78075406 missense probably benign 0.39
R1881:Eral1 UTSW 11 78076049 missense possibly damaging 0.67
R1995:Eral1 UTSW 11 78074489 missense probably benign
R2189:Eral1 UTSW 11 78075831 missense probably benign 0.15
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R4049:Eral1 UTSW 11 78075602 missense probably damaging 1.00
R4585:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4586:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4758:Eral1 UTSW 11 78075599 missense probably benign 0.20
R5613:Eral1 UTSW 11 78074404 intron probably benign
R5987:Eral1 UTSW 11 78080233 missense possibly damaging 0.90
R6048:Eral1 UTSW 11 78075783 missense probably benign 0.03
R6363:Eral1 UTSW 11 78074317 missense probably damaging 1.00
R6891:Eral1 UTSW 11 78075733 missense possibly damaging 0.76
R7384:Eral1 UTSW 11 78074101 missense possibly damaging 0.81
R7468:Eral1 UTSW 11 78075393 missense probably damaging 1.00
R7762:Eral1 UTSW 11 78074533 missense possibly damaging 0.94
R8304:Eral1 UTSW 11 78076002 missense probably damaging 0.96
R8419:Eral1 UTSW 11 78074080 missense possibly damaging 0.73
R8433:Eral1 UTSW 11 78075483 missense probably benign
X0066:Eral1 UTSW 11 78075765 missense probably damaging 1.00
Z1176:Eral1 UTSW 11 78075620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAATGAGACCCCAGATCTCTC -3'
(R):5'- GCTCAAATGCCAAGCTAGTC -3'

Sequencing Primer
(F):5'- AGTTCCTAAGTGGTGGCTCACAAC -3'
(R):5'- GCCAAGCTAGTCTCAAAGTTAAG -3'
Posted On2016-09-06