Incidental Mutation 'R5450:Ikzf3'
ID429294
Institutional Source Beutler Lab
Gene Symbol Ikzf3
Ensembl Gene ENSMUSG00000018168
Gene NameIKAROS family zinc finger 3
SynonymsZfpn1a3, Aiolos, 5830411O07Rik
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98464902-98546031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98467086 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 475 (R475H)
Ref Sequence ENSEMBL: ENSMUSP00000099430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103141]
Predicted Effect probably damaging
Transcript: ENSMUST00000103141
AA Change: R475H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: R475H

DomainStartEndE-ValueType
ZnF_C2H2 117 139 4.34e0 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 4.47e-3 SMART
ZnF_C2H2 201 221 7.11e0 SMART
ZnF_C2H2 450 472 7.11e0 SMART
ZnF_C2H2 478 502 1.64e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153902
Meta Mutation Damage Score 0.6830 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Ikzf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Ikzf3 APN 11 98488857 missense probably damaging 1.00
IGL01537:Ikzf3 APN 11 98516892 missense probably damaging 1.00
IGL03376:Ikzf3 APN 11 98488953 missense probably damaging 1.00
R0030:Ikzf3 UTSW 11 98467612 missense probably benign 0.01
R0266:Ikzf3 UTSW 11 98467317 missense probably benign
R1302:Ikzf3 UTSW 11 98516920 missense probably benign
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1500:Ikzf3 UTSW 11 98518695 missense probably benign 0.16
R1531:Ikzf3 UTSW 11 98490446 missense probably damaging 0.98
R1599:Ikzf3 UTSW 11 98467093 missense probably damaging 1.00
R1623:Ikzf3 UTSW 11 98490331 critical splice donor site probably null
R2154:Ikzf3 UTSW 11 98485649 nonsense probably null
R3915:Ikzf3 UTSW 11 98490586 missense probably damaging 1.00
R4004:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4005:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4075:Ikzf3 UTSW 11 98467643 nonsense probably null
R4210:Ikzf3 UTSW 11 98490487 missense probably benign 0.00
R4804:Ikzf3 UTSW 11 98490574 missense probably benign 0.20
R5107:Ikzf3 UTSW 11 98490476 missense probably damaging 1.00
R5266:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5267:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R6237:Ikzf3 UTSW 11 98467053 missense probably damaging 1.00
R6557:Ikzf3 UTSW 11 98516881 missense probably benign
R7832:Ikzf3 UTSW 11 98518699 missense probably benign
R8058:Ikzf3 UTSW 11 98516927 nonsense probably null
R8073:Ikzf3 UTSW 11 98467429 missense probably benign 0.05
Z1176:Ikzf3 UTSW 11 98467181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGACTGTTCATGTGGAC -3'
(R):5'- GAGGTCCCTCGCTCTTTTGAAC -3'

Sequencing Primer
(F):5'- TGTGGACATGATTGAGAGCTAAC -3'
(R):5'- GCTCTTTTGAACTCCTCAAGC -3'
Posted On2016-09-06