Incidental Mutation 'R5450:Zfp366'
ID429297
Institutional Source Beutler Lab
Gene Symbol Zfp366
Ensembl Gene ENSMUSG00000050919
Gene Namezinc finger protein 366
SynonymsDC-SCRIPT
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location99184823-99250656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99229585 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 418 (Y418C)
Ref Sequence ENSEMBL: ENSMUSP00000060040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056558]
Predicted Effect probably damaging
Transcript: ENSMUST00000056558
AA Change: Y418C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060040
Gene: ENSMUSG00000050919
AA Change: Y418C

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
ZnF_C2H2 250 272 1.18e-2 SMART
ZnF_C2H2 278 300 4.05e-1 SMART
ZnF_C2H2 306 328 1.79e-2 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 362 384 1.89e-1 SMART
ZnF_C2H2 390 412 1.22e-4 SMART
ZnF_C2H2 418 440 1.36e-2 SMART
ZnF_C2H2 446 468 1.1e-2 SMART
ZnF_C2H2 474 496 8.34e-3 SMART
ZnF_C2H2 502 524 5.42e-2 SMART
ZnF_C2H2 530 553 2.4e-3 SMART
low complexity region 615 623 N/A INTRINSIC
Meta Mutation Damage Score 0.7242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit perimembranous and muscular ventricular septal defects (VSD), and overriding aorta. Short snout, micrognathia, micropthalmia, hypoplastic thymus, and hydronephrosis are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Other mutations in Zfp366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp366 APN 13 99246572 utr 3 prime probably benign
IGL01626:Zfp366 APN 13 99228412 missense probably damaging 0.99
IGL02227:Zfp366 APN 13 99234188 missense possibly damaging 0.85
IGL03074:Zfp366 APN 13 99246405 missense probably benign
R0126:Zfp366 UTSW 13 99228621 missense probably benign 0.14
R0145:Zfp366 UTSW 13 99229540 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0376:Zfp366 UTSW 13 99234251 missense probably benign 0.00
R0537:Zfp366 UTSW 13 99229278 missense probably damaging 1.00
R0637:Zfp366 UTSW 13 99228966 missense probably damaging 0.99
R0838:Zfp366 UTSW 13 99228610 missense possibly damaging 0.73
R1386:Zfp366 UTSW 13 99246555 missense probably damaging 0.98
R1422:Zfp366 UTSW 13 99229296 missense probably damaging 1.00
R1669:Zfp366 UTSW 13 99229561 missense probably damaging 0.99
R1839:Zfp366 UTSW 13 99228492 missense probably damaging 0.98
R3751:Zfp366 UTSW 13 99228844 missense probably damaging 1.00
R4782:Zfp366 UTSW 13 99246483 missense probably damaging 1.00
R4908:Zfp366 UTSW 13 99234101 missense possibly damaging 0.68
R4992:Zfp366 UTSW 13 99229495 missense possibly damaging 0.62
R5040:Zfp366 UTSW 13 99228367 missense probably damaging 1.00
R5086:Zfp366 UTSW 13 99228943 missense probably benign 0.00
R5186:Zfp366 UTSW 13 99246168 missense probably benign 0.00
R5249:Zfp366 UTSW 13 99229609 missense probably damaging 1.00
R6838:Zfp366 UTSW 13 99228507 missense possibly damaging 0.93
R6838:Zfp366 UTSW 13 99246177 missense possibly damaging 0.83
R7250:Zfp366 UTSW 13 99229568 missense probably damaging 1.00
R7378:Zfp366 UTSW 13 99229515 missense probably damaging 1.00
R7571:Zfp366 UTSW 13 99246387 missense probably benign 0.03
R7624:Zfp366 UTSW 13 99246296 missense probably benign
R7653:Zfp366 UTSW 13 99229201 missense probably damaging 1.00
R8367:Zfp366 UTSW 13 99244043 missense possibly damaging 0.95
Z1176:Zfp366 UTSW 13 99246350 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAACATTTGTGTGGAGTGCGG -3'
(R):5'- TGGGAAGCGGGCATATTAGC -3'

Sequencing Primer
(F):5'- AGTGCGGCCTCGACTTC -3'
(R):5'- CAGAGCTCCTCGGCATTTTAGATAG -3'
Posted On2016-09-06