Mutagenetix > Incidental Mutations

Incidental Mutation 'R5450:Slc30a5'

429298

Institutional Source

Beutler Lab

Gene Symbol

Slc30a5

Ensembl Gene

ENSMUSG00000021629

Gene Name

solute carrier family 30 (zinc transporter), member 5

Synonyms

Zntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5

MMRRC Submission

043015-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.484) question?

Stock #

R5450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100802648-100833427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 100821172 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 130 (V130I)

Ref Sequence

ENSEMBL: ENSMUSP00000065764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]

AlphaFold

Q8R4H9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067246
AA Change: V130I

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: V130I

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
transmembrane domain	56	75	N/A	INTRINSIC
transmembrane domain	96	113	N/A	INTRINSIC
transmembrane domain	128	145	N/A	INTRINSIC
transmembrane domain	150	164	N/A	INTRINSIC
transmembrane domain	192	214	N/A	INTRINSIC
transmembrane domain	235	254	N/A	INTRINSIC
transmembrane domain	264	286	N/A	INTRINSIC
transmembrane domain	299	321	N/A	INTRINSIC
transmembrane domain	341	360	N/A	INTRINSIC
Pfam:Cation_efflux	417	645	1.9e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224177

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225922
AA Change: V130I

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.0675

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
AF067063	A	T	13: 119,828,363	V99E	probably damaging	Het
Arhgef4	T	G	1: 34,807,324		probably benign	Het
Atg14	T	C	14: 47,551,464	N144S	probably benign	Het
Cacna1h	A	T	17: 25,383,186	M1454K	probably damaging	Het
Catsperb	A	T	12: 101,446,068	H138L	possibly damaging	Het
Ccdc129	T	A	6: 55,968,811		probably null	Het
Cd200r2	T	A	16: 44,909,571	D159E	probably benign	Het
Cd79a	G	T	7: 24,899,262	G79C	probably damaging	Het
Ceacam20	A	G	7: 19,978,208	H38R	possibly damaging	Het
Cers1	T	C	8: 70,318,297	L119P	probably damaging	Het
Ces1f	C	A	8: 93,265,795	V343L	probably benign	Het
Ces3a	G	A	8: 105,057,918	G511S	possibly damaging	Het
Cyfip2	A	G	11: 46,284,252	C98R	probably benign	Het
Cyp2j11	C	A	4: 96,339,876	V169L	probably benign	Het
Cyp4f17	A	G	17: 32,528,886	T523A	probably benign	Het
Ddx31	T	C	2: 28,886,969	S567P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsg1b	A	C	18: 20,409,064	H876P	probably damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Eno4	T	C	19: 58,960,247	F393S	possibly damaging	Het
Eral1	C	T	11: 78,078,357	D106N	probably benign	Het
Esp18	G	T	17: 39,408,179	R23M	probably benign	Het
Fam184b	C	T	5: 45,539,801	V674I	probably benign	Het
Fbxw13	A	C	9: 109,184,157	N154K	probably benign	Het
Gtpbp6	A	G	5: 110,107,125	V130A	probably damaging	Het
Hc	T	C	2: 35,013,038	D1067G	possibly damaging	Het
Ighg1	A	T	12: 113,330,506	S6T	unknown	Het
Ikzf3	C	T	11: 98,467,086	R475H	probably damaging	Het
Kcmf1	A	T	6: 72,842,930	L311*	probably null	Het
Kmt2d	C	A	15: 98,855,086	E184D	probably damaging	Het
Lrguk	A	T	6: 34,071,061	I314F	probably damaging	Het
Maml2	A	C	9: 13,706,467	S370R	probably damaging	Het
Mroh1	C	A	15: 76,432,347		probably benign	Het
Mx1	A	T	16: 97,454,147	Y235*	probably null	Het
Olfr1269	A	G	2: 90,118,669	*310Q	probably null	Het
Pamr1	T	G	2: 102,639,317	Y403D	probably damaging	Het
Panx2	A	G	15: 89,068,959	E551G	possibly damaging	Het
Patl2	A	G	2: 122,125,281	V258A	probably benign	Het
Ppm1m	A	G	9: 106,196,842	F255L	probably benign	Het
Prpf40a	G	T	2: 53,156,926	T266N	possibly damaging	Het
Psg18	T	A	7: 18,353,425	I103F	probably benign	Het
Rpl39-ps	A	G	15: 102,635,148		noncoding transcript	Het
Rps6kb1	A	T	11: 86,532,837	F106I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sardh	G	T	2: 27,239,698	T245K	possibly damaging	Het
Shprh	T	G	10: 11,212,330	I1619S	possibly damaging	Het
Skint1	G	A	4: 112,025,532	V258I	probably benign	Het
Slc27a5	T	C	7: 12,994,942	D331G	probably benign	Het
Slc29a2	A	G	19: 5,029,275	I309V	probably benign	Het
Slc4a3	C	A	1: 75,552,656	A531D	probably damaging	Het
Slc6a16	C	T	7: 45,261,248	T399I	probably benign	Het
Slitrk6	T	A	14: 110,750,097	H726L	probably benign	Het
Snx2	A	G	18: 53,210,712	K309R	probably damaging	Het
Speer4f2	T	A	5: 17,373,219	C4S	possibly damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Tmem8b	G	A	4: 43,673,992	V208I	probably benign	Het
Vmn1r47	T	C	6: 90,022,213	L109P	probably damaging	Het
Vmn1r73	C	A	7: 11,756,449	Q65K	possibly damaging	Het
Vmn1r76	T	C	7: 11,930,684	Y166C	probably damaging	Het
Vmn2r2	T	C	3: 64,126,590	T504A	probably benign	Het
Wdr75	C	A	1: 45,812,164	A300E	probably benign	Het
Yars	A	G	4: 129,197,246	E149G	possibly damaging	Het
Zbtb18	T	C	1: 177,447,205	F35L	probably damaging	Het
Zfp366	A	G	13: 99,229,585	Y418C	probably damaging	Het

Other mutations in Slc30a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Slc30a5	APN	13	100806666	missense	probably damaging	1.00
IGL01647:Slc30a5	APN	13	100821145	missense	possibly damaging	0.66
IGL02338:Slc30a5	APN	13	100803433	missense	probably damaging	0.99
IGL02408:Slc30a5	APN	13	100813724	missense	probably damaging	1.00
IGL02582:Slc30a5	APN	13	100812647	critical splice donor site	probably null
IGL02987:Slc30a5	APN	13	100803915	missense	probably damaging	1.00
IGL03025:Slc30a5	APN	13	100813887	missense	probably damaging	0.99
IGL03064:Slc30a5	APN	13	100811310	missense	probably damaging	1.00
IGL03089:Slc30a5	APN	13	100813830	missense	probably benign	0.01
IGL03268:Slc30a5	APN	13	100806703	missense	probably damaging	1.00
R0083:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0153:Slc30a5	UTSW	13	100826494	missense	possibly damaging	0.46
R0542:Slc30a5	UTSW	13	100809285	splice site	probably null
R0601:Slc30a5	UTSW	13	100814770	intron	probably benign
R1125:Slc30a5	UTSW	13	100803413	missense	probably damaging	1.00
R1434:Slc30a5	UTSW	13	100803442	missense	probably damaging	0.98
R1673:Slc30a5	UTSW	13	100813383	missense	probably benign	0.13
R1762:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R1974:Slc30a5	UTSW	13	100813953	missense	probably benign	0.06
R2082:Slc30a5	UTSW	13	100806533	critical splice donor site	probably null
R2151:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2152:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2153:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R3899:Slc30a5	UTSW	13	100818147	missense	probably benign	0.18
R4009:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4010:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4270:Slc30a5	UTSW	13	100829013	missense	probably benign	0.04
R4815:Slc30a5	UTSW	13	100813710	missense	probably damaging	1.00
R5048:Slc30a5	UTSW	13	100806741	missense	probably damaging	1.00
R5638:Slc30a5	UTSW	13	100813872	nonsense	probably null
R5892:Slc30a5	UTSW	13	100813302	missense	probably damaging	1.00
R5911:Slc30a5	UTSW	13	100809092	missense	probably damaging	1.00
R6453:Slc30a5	UTSW	13	100814689	missense	probably benign	0.00
R6769:Slc30a5	UTSW	13	100813860	missense	probably benign	0.19
R6795:Slc30a5	UTSW	13	100817069	missense	probably damaging	1.00
R7020:Slc30a5	UTSW	13	100824913	splice site	probably null
R7224:Slc30a5	UTSW	13	100809254	missense	probably damaging	0.99
R7305:Slc30a5	UTSW	13	100811424	missense	probably damaging	0.98
R7318:Slc30a5	UTSW	13	100813969	missense	probably benign	0.13
R7411:Slc30a5	UTSW	13	100818180	missense	probably benign	0.15
R7563:Slc30a5	UTSW	13	100803972	missense	probably benign	0.30
R8039:Slc30a5	UTSW	13	100813681	critical splice donor site	probably null
R8061:Slc30a5	UTSW	13	100828911	missense	probably damaging	0.99
R8973:Slc30a5	UTSW	13	100806694	missense	probably damaging	0.99
R9150:Slc30a5	UTSW	13	100803407	nonsense	probably null
R9352:Slc30a5	UTSW	13	100803872	missense	probably benign	0.10
R9359:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R9405:Slc30a5	UTSW	13	100813908	missense	probably benign	0.00
R9407:Slc30a5	UTSW	13	100814706	nonsense	probably null
X0019:Slc30a5	UTSW	13	100813842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGGCAGAGGCATTTATACAATC -3'
(R):5'- GCCAATACTAAAATGTTCTCCAAGG -3'

Sequencing Primer
(F):5'- AAGTACACTGTAGCTGTCTCCAG -3'
(R):5'- AAATGTTCTCCAAGGAATTGTCC -3'

Posted On

2016-09-06