Incidental Mutation 'R5366:Tmprss11c'
ID429327
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86282134 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 24 (T24I)
Ref Sequence ENSEMBL: ENSMUSP00000142902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059424
AA Change: T24I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: T24I

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196462
AA Change: T24I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: T24I

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8164:Tmprss11c UTSW 5 86231853 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8416:Tmprss11c UTSW 5 86239417 missense probably damaging 1.00
R8426:Tmprss11c UTSW 5 86231818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGAGGACAAACTTTTGCG -3'
(R):5'- AATGTATGCACAAACTCCACTG -3'

Sequencing Primer
(F):5'- CTGAGGACAAACTTTTGCGATGAAC -3'
(R):5'- ATGTATGCACAAACTCCACTGTTTCG -3'
Posted On2016-09-06