Incidental Mutation 'R5366:4931406P16Rik'
ID429339
Institutional Source Beutler Lab
Gene Symbol 4931406P16Rik
Ensembl Gene ENSMUSG00000066571
Gene NameRIKEN cDNA 4931406P16 gene
Synonyms
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location34236707-34313551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34242288 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 657 (M657K)
Ref Sequence ENSEMBL: ENSMUSP00000145762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]
Predicted Effect probably benign
Transcript: ENSMUST00000085592
AA Change: M869K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: M869K

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108074
AA Change: M869K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: M869K

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127010
Predicted Effect probably benign
Transcript: ENSMUST00000205264
AA Change: M153K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206245
Predicted Effect possibly damaging
Transcript: ENSMUST00000206399
AA Change: M657K

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in 4931406P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:4931406P16Rik APN 7 34245987 splice site probably benign
IGL00160:4931406P16Rik APN 7 34239006 missense possibly damaging 0.88
IGL00691:4931406P16Rik APN 7 34245485 missense probably damaging 1.00
IGL01312:4931406P16Rik APN 7 34256508 missense probably benign 0.19
IGL01954:4931406P16Rik APN 7 34245035 missense probably damaging 1.00
IGL02016:4931406P16Rik APN 7 34239101 missense possibly damaging 0.74
IGL02390:4931406P16Rik APN 7 34248218 missense probably damaging 1.00
IGL02407:4931406P16Rik APN 7 34256484 missense probably damaging 0.99
IGL02677:4931406P16Rik APN 7 34242409 splice site probably benign
IGL02929:4931406P16Rik APN 7 34245082 missense possibly damaging 0.46
IGL03285:4931406P16Rik APN 7 34284991 missense possibly damaging 0.81
I1329:4931406P16Rik UTSW 7 34245194 missense probably benign 0.00
R0004:4931406P16Rik UTSW 7 34256428 missense probably damaging 0.99
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0135:4931406P16Rik UTSW 7 34245957 missense probably damaging 1.00
R0137:4931406P16Rik UTSW 7 34239219 missense probably damaging 1.00
R0556:4931406P16Rik UTSW 7 34239797 missense probably damaging 0.99
R0687:4931406P16Rik UTSW 7 34245418 missense possibly damaging 0.95
R0928:4931406P16Rik UTSW 7 34248246 splice site probably null
R1719:4931406P16Rik UTSW 7 34248206 missense probably damaging 0.98
R1908:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1909:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1976:4931406P16Rik UTSW 7 34257380 missense probably damaging 0.99
R2496:4931406P16Rik UTSW 7 34256491 missense possibly damaging 0.93
R3005:4931406P16Rik UTSW 7 34284784 missense probably damaging 1.00
R4666:4931406P16Rik UTSW 7 34284773 missense probably damaging 0.98
R4832:4931406P16Rik UTSW 7 34238908 utr 3 prime probably benign
R4870:4931406P16Rik UTSW 7 34284887 missense possibly damaging 0.83
R4989:4931406P16Rik UTSW 7 34245800 missense probably damaging 1.00
R5033:4931406P16Rik UTSW 7 34245812 missense probably benign
R5308:4931406P16Rik UTSW 7 34245755 nonsense probably null
R5386:4931406P16Rik UTSW 7 34242388 missense probably damaging 0.99
R5688:4931406P16Rik UTSW 7 34253991 missense possibly damaging 0.74
R5688:4931406P16Rik UTSW 7 34284709 missense probably damaging 0.99
R5714:4931406P16Rik UTSW 7 34240516 nonsense probably null
R5733:4931406P16Rik UTSW 7 34245080 missense probably damaging 0.99
R5772:4931406P16Rik UTSW 7 34253988 missense probably damaging 0.97
R6059:4931406P16Rik UTSW 7 34245463 missense possibly damaging 0.90
R6211:4931406P16Rik UTSW 7 34239004 missense possibly damaging 0.95
R6276:4931406P16Rik UTSW 7 34242377 nonsense probably null
R6477:4931406P16Rik UTSW 7 34257630 critical splice donor site probably null
R6757:4931406P16Rik UTSW 7 34239077 missense possibly damaging 0.89
R6912:4931406P16Rik UTSW 7 34245668 missense probably benign
R7156:4931406P16Rik UTSW 7 34245708 missense possibly damaging 0.80
R7317:4931406P16Rik UTSW 7 34263647 missense probably benign
R7431:4931406P16Rik UTSW 7 34284794 missense possibly damaging 0.73
R7452:4931406P16Rik UTSW 7 34245671 missense probably benign
R7996:4931406P16Rik UTSW 7 34263599 missense possibly damaging 0.77
R8348:4931406P16Rik UTSW 7 34285144 missense probably damaging 1.00
R8448:4931406P16Rik UTSW 7 34285144 missense probably damaging 1.00
RF019:4931406P16Rik UTSW 7 34240549 missense probably damaging 0.98
X0021:4931406P16Rik UTSW 7 34245363 missense possibly damaging 0.94
Z1177:4931406P16Rik UTSW 7 34284755 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGTCACTCATTCATTGCAGGG -3'
(R):5'- AGGAAGAAGTCGATTTGGCC -3'

Sequencing Primer
(F):5'- CACTCATTCATTGCAGGGGTATG -3'
(R):5'- GAAGTCGATTTGGCCTTAAATCCTGC -3'
Posted On2016-09-06