Mutagenetix > Incidental Mutation

Incidental Mutation 'R5366:Cfap46'

429341

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik

MMRRC Submission

042944-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5366 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139600951-139683817 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139650886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 942 (L942P)

Ref Sequence

ENSEMBL: ENSMUSP00000120186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]

AlphaFold

E9Q2C0

Predicted Effect

probably damaging
Transcript: ENSMUST00000129990
AA Change: L942P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: L942P

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140820

SMART Domains

Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

Domain	Start	End	E-Value	Type
Blast:TPR	175	208	5e-11	BLAST
Blast:TPR	426	459	8e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156116

Meta Mutation Damage Score

0.6117

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

100% (77/77)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,242,288	M657K	possibly damaging	Het
4932431P20Rik	A	C	7: 29,533,539		noncoding transcript	Het
Abcb5	T	C	12: 118,867,930	N1229S	possibly damaging	Het
Adgre1	G	A	17: 57,402,817	C158Y	probably benign	Het
Ahnak	T	A	19: 9,016,735	S5128T	possibly damaging	Het
Ankrd36	T	A	11: 5,592,841	C322*	probably null	Het
Ano1	T	A	7: 144,654,209	T113S	possibly damaging	Het
Apeh	A	T	9: 108,091,806	S321T	probably benign	Het
Atg4d	T	A	9: 21,268,652	V273D	probably damaging	Het
Cacna2d4	A	G	6: 119,274,318	D489G	probably damaging	Het
Cd47	T	C	16: 49,896,373	F256L	probably damaging	Het
Cd84	A	T	1: 171,873,305	D211V	probably damaging	Het
Cfh	A	C	1: 140,136,235	C434W	probably damaging	Het
Chst2	T	C	9: 95,405,465	D276G	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Degs1	C	A	1: 182,279,362	D111Y	probably benign	Het
Dhps	T	A	8: 85,074,784	D313E	probably damaging	Het
Dock9	A	G	14: 121,578,203	C1645R	probably damaging	Het
Efcab7	A	C	4: 99,904,734	D407A	possibly damaging	Het
Eif3a	G	T	19: 60,779,533	T189N	probably benign	Het
Ep300	T	A	15: 81,616,100	L57M	probably benign	Het
Exoc6b	T	A	6: 84,890,531	I300L	probably benign	Het
Fam69c	T	A	18: 84,730,595	L106Q	probably damaging	Het
Fzd8	T	C	18: 9,213,880	S321P	probably damaging	Het
Gm9920	T	A	15: 55,112,309		probably benign	Het
Gucy2c	A	G	6: 136,720,741	I668T	probably damaging	Het
Irgc1	C	T	7: 24,433,426		probably benign	Het
Jsrp1	G	T	10: 80,810,196	S143*	probably null	Het
Kctd4	T	C	14: 75,962,819	Y77H	probably damaging	Het
Klhdc1	T	A	12: 69,283,150	I351N	probably damaging	Het
Klra17	C	T	6: 129,874,895	E5K	possibly damaging	Het
Mapk8	A	T	14: 33,390,729	V211E	probably damaging	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mrc1	T	C	2: 14,321,914	Y1208H	probably benign	Het
Mrps16	A	T	14: 20,391,455	S94T	probably benign	Het
Muc5ac	A	G	7: 141,807,550	T1533A	probably benign	Het
Myh10	A	T	11: 68,760,692	D287V	probably damaging	Het
Obscn	T	C	11: 59,080,260	T2476A	probably damaging	Het
Olfm2	T	A	9: 20,668,412	T356S	probably benign	Het
Olfr1313	T	C	2: 112,072,478	Y35C	possibly damaging	Het
P2rx2	T	A	5: 110,341,828	N108I	probably damaging	Het
Pbx4	A	T	8: 69,870,170	T309S	probably benign	Het
Phyhip	C	A	14: 70,466,855	H171Q	probably benign	Het
Pou4f3	A	G	18: 42,395,754	E254G	probably damaging	Het
Pxdn	C	A	12: 30,002,900	H845Q	probably damaging	Het
Rgcc	T	C	14: 79,291,683	T111A	probably benign	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Sgsm1	C	A	5: 113,251,039	E722D	possibly damaging	Het
Soat1	A	T	1: 156,444,611	D101E	probably benign	Het
Spag5	T	A	11: 78,320,326		probably null	Het
Spata31	A	T	13: 64,920,459	E140D	probably damaging	Het
Srrm2	T	A	17: 23,818,704	S1537T	probably benign	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Tbc1d4	G	T	14: 101,607,976	T162K	possibly damaging	Het
Tmem163	A	C	1: 127,500,305		probably benign	Het
Tmem43	T	C	6: 91,478,258	V72A	probably benign	Het
Tmprss11c	G	A	5: 86,282,134	T24I	possibly damaging	Het
Trerf1	A	T	17: 47,315,190		noncoding transcript	Het
Trim44	A	G	2: 102,400,131	L185P	probably damaging	Het
Tspyl1	A	G	10: 34,282,345	D22G	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tyro3	G	A	2: 119,804,831	R201Q	probably damaging	Het
Ubxn2a	T	A	12: 4,880,741	K206N	probably benign	Het
Usp17lb	G	T	7: 104,840,408	H436Q	possibly damaging	Het
Vps9d1	A	G	8: 123,245,114	I584T	possibly damaging	Het
Vrk1	T	A	12: 106,055,819	M131K	possibly damaging	Het
Zfp827	A	T	8: 79,185,704	K986N	possibly damaging	Het
Zswim4	A	G	8: 84,212,790	M821T	probably benign	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139614443	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139666979	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139606607	missense	unknown
IGL02171:Cfap46	APN	7	139667056	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139682509	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139614470	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139607201	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139603252	missense	unknown
IGL03329:Cfap46	APN	7	139601165	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139638795	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139645551	missense
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139654566	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139651533	splice site	probably benign
R0650:Cfap46	UTSW	7	139605655	missense	unknown
R0675:Cfap46	UTSW	7	139676034	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139654670	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139655841	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139642597	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139601265	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139654629	nonsense	probably null
R1538:Cfap46	UTSW	7	139683008	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139652810	missense	probably benign	0.04
R1655:Cfap46	UTSW	7	139642520	nonsense	probably null
R1824:Cfap46	UTSW	7	139639602	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139640407	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139653408	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139683470	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139679903	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139667041	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139683761	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139661046	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139653498	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139617590	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139639599	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139678551	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139652673	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139650952	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139660082	intron	probably benign
R4595:Cfap46	UTSW	7	139652404	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139657281	missense	probably damaging	0.99
R4627:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4628:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139627456	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139679323	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139630608	missense	probably null
R4779:Cfap46	UTSW	7	139659815	intron	probably benign
R4812:Cfap46	UTSW	7	139636000	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139607188	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139627375	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139603860	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139661190	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139678514	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139613507	critical splice donor site	probably null
R5368:Cfap46	UTSW	7	139627473	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139632181	splice site	probably null
R5642:Cfap46	UTSW	7	139678577	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139638353	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139606700	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139612031	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139650942	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139651595	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139656580	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139661085	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139680831	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139614405	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139619971	missense	possibly damaging	0.92
R6760:Cfap46	UTSW	7	139652440	missense	probably damaging	1.00
R6773:Cfap46	UTSW	7	139642561	utr 3 prime	probably benign
R6835:Cfap46	UTSW	7	139652498	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139654561	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139639700	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139618078	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139617577	missense	unknown
R7327:Cfap46	UTSW	7	139635146	splice site	probably null
R7336:Cfap46	UTSW	7	139620104	missense	unknown
R7337:Cfap46	UTSW	7	139630576	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139650837	nonsense	probably null
R7450:Cfap46	UTSW	7	139617437	missense	unknown
R7495:Cfap46	UTSW	7	139603196	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139603239	missense
R7623:Cfap46	UTSW	7	139618350	missense	unknown
R7765:Cfap46	UTSW	7	139651564	missense
R7971:Cfap46	UTSW	7	139635127	missense	unknown
R8211:Cfap46	UTSW	7	139633304	missense	unknown
R8306:Cfap46	UTSW	7	139656580	missense
R8354:Cfap46	UTSW	7	139653498	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139683084	nonsense	probably null
R8447:Cfap46	UTSW	7	139680986	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139605644	missense
R8805:Cfap46	UTSW	7	139632063	missense	unknown
R8830:Cfap46	UTSW	7	139615649	missense	unknown
R8912:Cfap46	UTSW	7	139680181	intron	probably benign
R8920:Cfap46	UTSW	7	139652526	missense
R8977:Cfap46	UTSW	7	139679933	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139627343	missense	unknown
R9224:Cfap46	UTSW	7	139678500	nonsense	probably null
R9243:Cfap46	UTSW	7	139615349	intron	probably benign
R9252:Cfap46	UTSW	7	139618249	missense	unknown
R9276:Cfap46	UTSW	7	139621291	missense	unknown
R9301:Cfap46	UTSW	7	139642545	missense
R9391:Cfap46	UTSW	7	139618111	missense	unknown
R9402:Cfap46	UTSW	7	139635949	missense	unknown
R9443:Cfap46	UTSW	7	139615107	missense
R9564:Cfap46	UTSW	7	139651555	missense
R9625:Cfap46	UTSW	7	139650889	missense
R9626:Cfap46	UTSW	7	139650889	missense
R9638:Cfap46	UTSW	7	139629847	missense	unknown
R9656:Cfap46	UTSW	7	139655900	missense
R9658:Cfap46	UTSW	7	139666313	missense
R9747:Cfap46	UTSW	7	139611991	missense	unknown
RF023:Cfap46	UTSW	7	139638918
W0251:Cfap46	UTSW	7	139603946	missense	probably benign	0.11
X0018:Cfap46	UTSW	7	139680912	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139603447	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139635064	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139639548	missense
Z1177:Cfap46	UTSW	7	139601267	missense	unknown
Z1177:Cfap46	UTSW	7	139630626	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGACACACTCCTTGCTCTGC -3'
(R):5'- GCATAGCAATCCCTATCAGCATG -3'

Sequencing Primer
(F):5'- CTCTGCTTCTCTGGGGATGTTAC -3'
(R):5'- ATGCATGCTAAGCCATGTGC -3'

Posted On

2016-09-06