Incidental Mutation 'R5366:Spag5'
ID429357
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Namesperm associated antigen 5
SynonymsD11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78301529-78322457 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 78320326 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017534] [ENSMUST00000045026] [ENSMUST00000045026] [ENSMUST00000102478]
Predicted Effect probably benign
Transcript: ENSMUST00000017534
SMART Domains Protein: ENSMUSP00000017534
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 2.6e-185 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000045026
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045026
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102478
SMART Domains Protein: ENSMUSP00000099536
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 5.5e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150016
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78304617 missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78304259 missense probably benign 0.06
IGL02066:Spag5 APN 11 78304532 missense probably benign
IGL02140:Spag5 APN 11 78315633 missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78320034 missense probably damaging 1.00
IGL02452:Spag5 APN 11 78304623 missense probably benign 0.08
IGL02658:Spag5 APN 11 78321331 nonsense probably null
boyardee UTSW 11 78313191 critical splice donor site probably null
Franco UTSW 11 78314182 nonsense probably null
spaghetto UTSW 11 78313379 nonsense probably null
IGL02991:Spag5 UTSW 11 78314251 missense probably damaging 0.99
R0477:Spag5 UTSW 11 78314198 missense probably damaging 1.00
R0512:Spag5 UTSW 11 78319586 unclassified probably benign
R0535:Spag5 UTSW 11 78304728 missense probably benign 0.00
R0557:Spag5 UTSW 11 78314211 missense probably damaging 0.99
R0584:Spag5 UTSW 11 78304095 missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78313396 missense probably damaging 1.00
R0723:Spag5 UTSW 11 78319584 unclassified probably benign
R1413:Spag5 UTSW 11 78305317 nonsense probably null
R1680:Spag5 UTSW 11 78320616 missense probably damaging 1.00
R1687:Spag5 UTSW 11 78304929 missense probably benign 0.32
R1696:Spag5 UTSW 11 78321326 missense probably damaging 1.00
R1831:Spag5 UTSW 11 78314256 missense probably benign 0.08
R1866:Spag5 UTSW 11 78304455 missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78304176 missense probably benign 0.01
R4004:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4005:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4222:Spag5 UTSW 11 78304511 missense probably damaging 1.00
R4750:Spag5 UTSW 11 78320052 missense probably benign 0.00
R4771:Spag5 UTSW 11 78304766 missense probably damaging 1.00
R4928:Spag5 UTSW 11 78314373 missense probably damaging 0.97
R5360:Spag5 UTSW 11 78314762 missense probably damaging 0.99
R5618:Spag5 UTSW 11 78304080 missense probably benign 0.00
R5668:Spag5 UTSW 11 78304716 missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78304146 missense probably benign 0.25
R5859:Spag5 UTSW 11 78313534 missense probably benign 0.38
R6564:Spag5 UTSW 11 78315575 missense probably damaging 1.00
R6571:Spag5 UTSW 11 78321269 missense probably damaging 1.00
R6573:Spag5 UTSW 11 78314182 nonsense probably null
R7074:Spag5 UTSW 11 78305042 critical splice donor site probably null
R7091:Spag5 UTSW 11 78313191 critical splice donor site probably null
R7332:Spag5 UTSW 11 78313379 nonsense probably null
R8073:Spag5 UTSW 11 78301977 missense probably benign 0.22
R8709:Spag5 UTSW 11 78301912 missense probably benign
R8723:Spag5 UTSW 11 78321389 missense probably damaging 1.00
Z1176:Spag5 UTSW 11 78314982 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAGTCAGAAGTGCTTTGCTC -3'
(R):5'- CAGGAGAATCTGGCATCATTCTC -3'

Sequencing Primer
(F):5'- CAGAAGTGCTTTGCTCTAAAAACCTC -3'
(R):5'- GAGAATCTGGCATCATTCTCATGCTC -3'
Posted On2016-09-06