Mutagenetix > Incidental Mutations

Incidental Mutation 'R5366:Abcb5'

429363

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

042944-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.181) question?

Stock #

R5366 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118867930 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1229 (N1229S)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035515
AA Change: N1229S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: N1229S

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Meta Mutation Damage Score

0.1321

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,242,288	M657K	possibly damaging	Het
4932431P20Rik	A	C	7: 29,533,539		noncoding transcript	Het
Adgre1	G	A	17: 57,402,817	C158Y	probably benign	Het
Ahnak	T	A	19: 9,016,735	S5128T	possibly damaging	Het
Ankrd36	T	A	11: 5,592,841	C322*	probably null	Het
Ano1	T	A	7: 144,654,209	T113S	possibly damaging	Het
Apeh	A	T	9: 108,091,806	S321T	probably benign	Het
Atg4d	T	A	9: 21,268,652	V273D	probably damaging	Het
Cacna2d4	A	G	6: 119,274,318	D489G	probably damaging	Het
Cd47	T	C	16: 49,896,373	F256L	probably damaging	Het
Cd84	A	T	1: 171,873,305	D211V	probably damaging	Het
Cfap46	A	G	7: 139,650,886	L942P	probably damaging	Het
Cfh	A	C	1: 140,136,235	C434W	probably damaging	Het
Chst2	T	C	9: 95,405,465	D276G	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Degs1	C	A	1: 182,279,362	D111Y	probably benign	Het
Dhps	T	A	8: 85,074,784	D313E	probably damaging	Het
Dock9	A	G	14: 121,578,203	C1645R	probably damaging	Het
Efcab7	A	C	4: 99,904,734	D407A	possibly damaging	Het
Eif3a	G	T	19: 60,779,533	T189N	probably benign	Het
Ep300	T	A	15: 81,616,100	L57M	probably benign	Het
Exoc6b	T	A	6: 84,890,531	I300L	probably benign	Het
Fam69c	T	A	18: 84,730,595	L106Q	probably damaging	Het
Fzd8	T	C	18: 9,213,880	S321P	probably damaging	Het
Gm9920	T	A	15: 55,112,309		probably benign	Het
Gucy2c	A	G	6: 136,720,741	I668T	probably damaging	Het
Irgc1	C	T	7: 24,433,426		probably benign	Het
Jsrp1	G	T	10: 80,810,196	S143*	probably null	Het
Kctd4	T	C	14: 75,962,819	Y77H	probably damaging	Het
Klhdc1	T	A	12: 69,283,150	I351N	probably damaging	Het
Klra17	C	T	6: 129,874,895	E5K	possibly damaging	Het
Mapk8	A	T	14: 33,390,729	V211E	probably damaging	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mrc1	T	C	2: 14,321,914	Y1208H	probably benign	Het
Mrps16	A	T	14: 20,391,455	S94T	probably benign	Het
Muc5ac	A	G	7: 141,807,550	T1533A	probably benign	Het
Myh10	A	T	11: 68,760,692	D287V	probably damaging	Het
Obscn	T	C	11: 59,080,260	T2476A	probably damaging	Het
Olfm2	T	A	9: 20,668,412	T356S	probably benign	Het
Olfr1313	T	C	2: 112,072,478	Y35C	possibly damaging	Het
P2rx2	T	A	5: 110,341,828	N108I	probably damaging	Het
Pbx4	A	T	8: 69,870,170	T309S	probably benign	Het
Phyhip	C	A	14: 70,466,855	H171Q	probably benign	Het
Pou4f3	A	G	18: 42,395,754	E254G	probably damaging	Het
Pxdn	C	A	12: 30,002,900	H845Q	probably damaging	Het
Rgcc	T	C	14: 79,291,683	T111A	probably benign	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Sgsm1	C	A	5: 113,251,039	E722D	possibly damaging	Het
Soat1	A	T	1: 156,444,611	D101E	probably benign	Het
Spag5	T	A	11: 78,320,326		probably null	Het
Spata31	A	T	13: 64,920,459	E140D	probably damaging	Het
Srrm2	T	A	17: 23,818,704	S1537T	probably benign	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Tbc1d4	G	T	14: 101,607,976	T162K	possibly damaging	Het
Tmem163	A	C	1: 127,500,305		probably benign	Het
Tmem43	T	C	6: 91,478,258	V72A	probably benign	Het
Tmprss11c	G	A	5: 86,282,134	T24I	possibly damaging	Het
Trerf1	A	T	17: 47,315,190		noncoding transcript	Het
Trim44	A	G	2: 102,400,131	L185P	probably damaging	Het
Tspyl1	A	G	10: 34,282,345	D22G	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tyro3	G	A	2: 119,804,831	R201Q	probably damaging	Het
Ubxn2a	T	A	12: 4,880,741	K206N	probably benign	Het
Usp17lb	G	T	7: 104,840,408	H436Q	possibly damaging	Het
Vps9d1	A	G	8: 123,245,114	I584T	possibly damaging	Het
Vrk1	T	A	12: 106,055,819	M131K	possibly damaging	Het
Zfp827	A	T	8: 79,185,704	K986N	possibly damaging	Het
Zswim4	A	G	8: 84,212,790	M821T	probably benign	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCAGACCAAGTAATTACTATGGAC -3'
(R):5'- CCCCATTTCTATCTGGCAGAG -3'

Sequencing Primer
(F):5'- TGGACTCTTCATTAGACCAAGATCC -3'
(R):5'- GTCCAACAGGCTCTTGA -3'

Posted On

2016-09-06