Incidental Mutation 'R5366:Ep300'
ID429376
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81616100 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 57 (L57M)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387] [ENSMUST00000206936]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: L534M
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: L534M

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185967
AA Change: L57M

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190035
Predicted Effect probably benign
Transcript: ENSMUST00000206936
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
BB001:Ep300 UTSW 15 81649502 missense unknown
BB011:Ep300 UTSW 15 81649502 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7699:Ep300 UTSW 15 81586393 start gained probably benign
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7924:Ep300 UTSW 15 81649502 missense unknown
R8155:Ep300 UTSW 15 81621068 missense unknown
R8259:Ep300 UTSW 15 81639017 missense unknown
R8276:Ep300 UTSW 15 81650028 missense possibly damaging 0.85
R8331:Ep300 UTSW 15 81601210 missense unknown
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGTCTGTGTTTTCCTATTTCACTT -3'
(R):5'- GTCTGTGACTCACATGTCAAGTA -3'

Sequencing Primer
(F):5'- CCAATGAGGTCTGGAGATCATTCC -3'
(R):5'- ACTCACATGTCAAGTATATATGTGTG -3'
Posted On2016-09-06