Mutagenetix > Incidental Mutation

Incidental Mutation 'R5366:Fzd8'

429382

Institutional Source

Beutler Lab

Gene Symbol

Fzd8

Ensembl Gene

ENSMUSG00000036904

Gene Name

frizzled class receptor 8

Synonyms

mFZ8, Fz8

MMRRC Submission

042944-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5366 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9212856-9216201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9213880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 321 (S321P)

Ref Sequence

ENSEMBL: ENSMUSP00000039660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041080]

AlphaFold

Q61091

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041080
AA Change: S321P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: S321P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FRI	34	153	9.06e-73	SMART
low complexity region	161	228	N/A	INTRINSIC
Frizzled	264	621	1.47e-219	SMART
low complexity region	624	655	N/A	INTRINSIC

Meta Mutation Damage Score

0.4026

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,242,288	M657K	possibly damaging	Het
4932431P20Rik	A	C	7: 29,533,539		noncoding transcript	Het
Abcb5	T	C	12: 118,867,930	N1229S	possibly damaging	Het
Adgre1	G	A	17: 57,402,817	C158Y	probably benign	Het
Ahnak	T	A	19: 9,016,735	S5128T	possibly damaging	Het
Ankrd36	T	A	11: 5,592,841	C322*	probably null	Het
Ano1	T	A	7: 144,654,209	T113S	possibly damaging	Het
Apeh	A	T	9: 108,091,806	S321T	probably benign	Het
Atg4d	T	A	9: 21,268,652	V273D	probably damaging	Het
Cacna2d4	A	G	6: 119,274,318	D489G	probably damaging	Het
Cd47	T	C	16: 49,896,373	F256L	probably damaging	Het
Cd84	A	T	1: 171,873,305	D211V	probably damaging	Het
Cfap46	A	G	7: 139,650,886	L942P	probably damaging	Het
Cfh	A	C	1: 140,136,235	C434W	probably damaging	Het
Chst2	T	C	9: 95,405,465	D276G	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Degs1	C	A	1: 182,279,362	D111Y	probably benign	Het
Dhps	T	A	8: 85,074,784	D313E	probably damaging	Het
Dock9	A	G	14: 121,578,203	C1645R	probably damaging	Het
Efcab7	A	C	4: 99,904,734	D407A	possibly damaging	Het
Eif3a	G	T	19: 60,779,533	T189N	probably benign	Het
Ep300	T	A	15: 81,616,100	L57M	probably benign	Het
Exoc6b	T	A	6: 84,890,531	I300L	probably benign	Het
Fam69c	T	A	18: 84,730,595	L106Q	probably damaging	Het
Gm9920	T	A	15: 55,112,309		probably benign	Het
Gucy2c	A	G	6: 136,720,741	I668T	probably damaging	Het
Irgc1	C	T	7: 24,433,426		probably benign	Het
Jsrp1	G	T	10: 80,810,196	S143*	probably null	Het
Kctd4	T	C	14: 75,962,819	Y77H	probably damaging	Het
Klhdc1	T	A	12: 69,283,150	I351N	probably damaging	Het
Klra17	C	T	6: 129,874,895	E5K	possibly damaging	Het
Mapk8	A	T	14: 33,390,729	V211E	probably damaging	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mrc1	T	C	2: 14,321,914	Y1208H	probably benign	Het
Mrps16	A	T	14: 20,391,455	S94T	probably benign	Het
Muc5ac	A	G	7: 141,807,550	T1533A	probably benign	Het
Myh10	A	T	11: 68,760,692	D287V	probably damaging	Het
Obscn	T	C	11: 59,080,260	T2476A	probably damaging	Het
Olfm2	T	A	9: 20,668,412	T356S	probably benign	Het
Olfr1313	T	C	2: 112,072,478	Y35C	possibly damaging	Het
P2rx2	T	A	5: 110,341,828	N108I	probably damaging	Het
Pbx4	A	T	8: 69,870,170	T309S	probably benign	Het
Phyhip	C	A	14: 70,466,855	H171Q	probably benign	Het
Pou4f3	A	G	18: 42,395,754	E254G	probably damaging	Het
Pxdn	C	A	12: 30,002,900	H845Q	probably damaging	Het
Rgcc	T	C	14: 79,291,683	T111A	probably benign	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Sgsm1	C	A	5: 113,251,039	E722D	possibly damaging	Het
Soat1	A	T	1: 156,444,611	D101E	probably benign	Het
Spag5	T	A	11: 78,320,326		probably null	Het
Spata31	A	T	13: 64,920,459	E140D	probably damaging	Het
Srrm2	T	A	17: 23,818,704	S1537T	probably benign	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Tbc1d4	G	T	14: 101,607,976	T162K	possibly damaging	Het
Tmem163	A	C	1: 127,500,305		probably benign	Het
Tmem43	T	C	6: 91,478,258	V72A	probably benign	Het
Tmprss11c	G	A	5: 86,282,134	T24I	possibly damaging	Het
Trerf1	A	T	17: 47,315,190		noncoding transcript	Het
Trim44	A	G	2: 102,400,131	L185P	probably damaging	Het
Tspyl1	A	G	10: 34,282,345	D22G	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tyro3	G	A	2: 119,804,831	R201Q	probably damaging	Het
Ubxn2a	T	A	12: 4,880,741	K206N	probably benign	Het
Usp17lb	G	T	7: 104,840,408	H436Q	possibly damaging	Het
Vps9d1	A	G	8: 123,245,114	I584T	possibly damaging	Het
Vrk1	T	A	12: 106,055,819	M131K	possibly damaging	Het
Zfp827	A	T	8: 79,185,704	K986N	possibly damaging	Het
Zswim4	A	G	8: 84,212,790	M821T	probably benign	Het

Other mutations in Fzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fzd8	APN	18	9213068	missense	unknown
IGL01511:Fzd8	APN	18	9213293	missense	unknown
IGL03129:Fzd8	APN	18	9214270	missense	probably damaging	1.00
Stilt	UTSW	18	9213880	missense	probably damaging	1.00
R0058:Fzd8	UTSW	18	9213985	missense	possibly damaging	0.92
R0715:Fzd8	UTSW	18	9212947	missense	unknown
R0966:Fzd8	UTSW	18	9214745	missense	probably damaging	0.99
R1717:Fzd8	UTSW	18	9214364	missense	probably damaging	1.00
R1751:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1761:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1905:Fzd8	UTSW	18	9213803	missense	probably damaging	1.00
R1956:Fzd8	UTSW	18	9214502	missense	probably damaging	1.00
R2892:Fzd8	UTSW	18	9214514	missense	probably damaging	1.00
R3897:Fzd8	UTSW	18	9214939	missense	possibly damaging	0.89
R3968:Fzd8	UTSW	18	9214070	missense	probably damaging	0.98
R4934:Fzd8	UTSW	18	9214492	frame shift	probably null
R5624:Fzd8	UTSW	18	9213268	missense	unknown
R6261:Fzd8	UTSW	18	9214598	missense	possibly damaging	0.61
R6757:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6758:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6899:Fzd8	UTSW	18	9214729	missense	probably damaging	0.98
R7242:Fzd8	UTSW	18	9214171	missense	probably damaging	1.00
R8140:Fzd8	UTSW	18	9213797	missense	probably damaging	1.00
R8324:Fzd8	UTSW	18	9214688	missense	probably damaging	1.00
R8722:Fzd8	UTSW	18	9213686	missense	possibly damaging	0.67
R8818:Fzd8	UTSW	18	9214474	missense	probably benign	0.26
R8820:Fzd8	UTSW	18	9213247	missense	unknown
R8913:Fzd8	UTSW	18	9213869	missense	probably damaging	1.00
R9036:Fzd8	UTSW	18	9214661	missense	probably damaging	1.00
R9401:Fzd8	UTSW	18	9213205	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TCTTTAGCCAGGATGAGCGC -3'
(R):5'- GACAGGATTACCCACCAGATG -3'

Sequencing Primer
(F):5'- ATGAGCGCGCCTTCACC -3'
(R):5'- CCAGTGGTTTCATAGCGAACATGC -3'

Posted On

2016-09-06