Incidental Mutation 'R5367:Coq10b'
ID 429387
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
MMRRC Submission 042945-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R5367 (G1)
Quality Score 153
Status Validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55092143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 37 (D37G)
Ref Sequence ENSEMBL: ENSMUSP00000084899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027125
AA Change: D37G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981
AA Change: D37G

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087617
AA Change: D37G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981
AA Change: D37G

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193614
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 59,947,057 (GRCm39) Y252H probably damaging Het
Aadat T C 8: 60,979,630 (GRCm39) I164T probably damaging Het
Adam11 A G 11: 102,664,479 (GRCm39) H389R probably benign Het
Alkbh5 G T 11: 60,429,529 (GRCm39) R94L possibly damaging Het
Ampd3 A G 7: 110,407,078 (GRCm39) K644R possibly damaging Het
Ankhd1 T A 18: 36,722,461 (GRCm39) L328H probably damaging Het
Ankrd55 G T 13: 112,455,036 (GRCm39) V45F probably damaging Het
Apol7c C A 15: 77,410,347 (GRCm39) V200F probably damaging Het
Arap1 G A 7: 101,058,337 (GRCm39) V721M probably damaging Het
Arhgef40 A G 14: 52,227,156 (GRCm39) D400G probably damaging Het
Bmp4 G T 14: 46,621,950 (GRCm39) T198K possibly damaging Het
Cblb T A 16: 52,025,016 (GRCm39) F970L probably damaging Het
Celf5 A G 10: 81,303,098 (GRCm39) S148P probably damaging Het
Ckap5 T A 2: 91,445,486 (GRCm39) C1708S possibly damaging Het
Clec2l T C 6: 38,654,459 (GRCm39) F147L possibly damaging Het
Cnksr1 T A 4: 133,957,525 (GRCm39) I465F possibly damaging Het
Cpq T G 15: 33,213,250 (GRCm39) Y90D possibly damaging Het
Depdc1a G A 3: 159,229,591 (GRCm39) probably null Het
Eif2ak4 T A 2: 118,266,639 (GRCm39) probably null Het
Eif3e C T 15: 43,115,700 (GRCm39) M355I probably damaging Het
Eif4e1b G A 13: 54,934,757 (GRCm39) V181M probably damaging Het
Erap1 A G 13: 74,794,680 (GRCm39) E113G probably damaging Het
Fads2 A G 19: 10,041,649 (GRCm39) L438P probably damaging Het
Fbl T A 7: 27,874,475 (GRCm39) V67E probably damaging Het
Gde1 A G 7: 118,304,629 (GRCm39) L82P probably damaging Het
Gm10226 T C 17: 21,910,884 (GRCm39) S40P possibly damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gm1988 T A 7: 38,823,204 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,502 (GRCm39) noncoding transcript Het
Grb14 C T 2: 64,747,653 (GRCm39) V369I probably benign Het
Jag1 T A 2: 136,927,014 (GRCm39) Q915L possibly damaging Het
Kdm5d G A Y: 941,645 (GRCm39) G1282D probably benign Het
Krt87 A T 15: 101,384,875 (GRCm39) L407Q probably damaging Het
Mlf1 A T 3: 67,301,296 (GRCm39) H118L probably damaging Het
Mmp10 G T 9: 7,505,603 (GRCm39) C289F probably damaging Het
Mroh2a A T 1: 88,182,687 (GRCm39) N1205I possibly damaging Het
Myo9a T A 9: 59,807,732 (GRCm39) S2029T probably damaging Het
Nap1l4 A C 7: 143,088,035 (GRCm39) S174R probably damaging Het
Nos3 A G 5: 24,576,942 (GRCm39) T490A probably benign Het
Or12d2 T A 17: 37,625,147 (GRCm39) I43F probably damaging Het
Or4k35 T A 2: 111,100,235 (GRCm39) Q159L possibly damaging Het
Or5a1 A G 19: 12,097,800 (GRCm39) V80A possibly damaging Het
Or5b106 G A 19: 13,123,865 (GRCm39) L53F probably damaging Het
Or5g23 A T 2: 85,438,718 (GRCm39) C179S probably damaging Het
Pdlim7 G C 13: 55,653,975 (GRCm39) T214S probably benign Het
Piezo2 T C 18: 63,197,802 (GRCm39) E1578G probably damaging Het
Ptcd1 T A 5: 145,084,715 (GRCm39) probably benign Het
Sart3 C T 5: 113,897,277 (GRCm39) probably null Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Scrn2 A G 11: 96,923,953 (GRCm39) D279G possibly damaging Het
Sh2d3c A G 2: 32,635,914 (GRCm39) D94G probably damaging Het
Slc12a4 A T 8: 106,678,266 (GRCm39) V309E probably damaging Het
Slc1a6 A G 10: 78,623,637 (GRCm39) E12G probably damaging Het
Smarcal1 T C 1: 72,635,135 (GRCm39) probably null Het
Smr3a T C 5: 88,155,897 (GRCm39) probably benign Het
Stox2 A G 8: 47,656,260 (GRCm39) I72T probably damaging Het
Tmem234 G T 4: 129,494,500 (GRCm39) probably benign Het
Tmem35b A G 4: 127,018,266 (GRCm39) Q20R possibly damaging Het
Tom1l2 G A 11: 60,132,634 (GRCm39) H430Y probably benign Het
Tpo T C 12: 30,153,289 (GRCm39) Y355C probably damaging Het
Tulp2 A G 7: 45,166,075 (GRCm39) N122S possibly damaging Het
Washc2 T A 6: 116,236,111 (GRCm39) L1194H probably damaging Het
Xbp1 T C 11: 5,471,910 (GRCm39) V12A probably benign Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1517:Coq10b UTSW 1 55,103,416 (GRCm39) missense probably damaging 1.00
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R1767:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2195:Coq10b UTSW 1 55,100,457 (GRCm39) missense probably damaging 1.00
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5534:Coq10b UTSW 1 55,103,359 (GRCm39) missense possibly damaging 0.83
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7836:Coq10b UTSW 1 55,092,013 (GRCm39) start gained probably benign
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9292:Coq10b UTSW 1 55,110,868 (GRCm39) missense probably damaging 1.00
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACTTAGTGGGAAGAGGCGTGTC -3'
(R):5'- TTAAACTTTCCCGACGGCCG -3'

Sequencing Primer
(F):5'- AAGAGGCGTGTCCAGCTG -3'
(R):5'- ACCTCTTGGAGACCGGAAG -3'
Posted On 2016-09-06