Incidental Mutation 'R5367:Olfr1277'
ID429393
Institutional Source Beutler Lab
Gene Symbol Olfr1277
Ensembl Gene ENSMUSG00000074965
Gene Nameolfactory receptor 1277
SynonymsMOR248-11, GA_x6K02T2Q125-72321818-72320907
MMRRC Submission 042945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5367 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111264946-111274106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111269890 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 159 (Q159L)
Ref Sequence ENSEMBL: ENSMUSP00000150703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099619] [ENSMUST00000214760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099619
AA Change: Q159L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097214
Gene: ENSMUSG00000074965
AA Change: Q159L

DomainStartEndE-ValueType
Pfam:7tm_4 31 303 5.5e-50 PFAM
Pfam:7tm_1 41 287 7.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214760
AA Change: Q159L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 60,039,636 Y252H probably damaging Het
Aadat T C 8: 60,526,596 I164T probably damaging Het
Adam11 A G 11: 102,773,653 H389R probably benign Het
Alkbh5 G T 11: 60,538,703 R94L possibly damaging Het
Ampd3 A G 7: 110,807,871 K644R possibly damaging Het
Ankhd1 T A 18: 36,589,408 L328H probably damaging Het
Ankrd55 G T 13: 112,318,502 V45F probably damaging Het
Apol7c C A 15: 77,526,147 V200F probably damaging Het
Arap1 G A 7: 101,409,130 V721M probably damaging Het
Arhgef40 A G 14: 51,989,699 D400G probably damaging Het
Bmp4 G T 14: 46,384,493 T198K possibly damaging Het
Cblb T A 16: 52,204,653 F970L probably damaging Het
Celf5 A G 10: 81,467,264 S148P probably damaging Het
Ckap5 T A 2: 91,615,141 C1708S possibly damaging Het
Clec2l T C 6: 38,677,524 F147L possibly damaging Het
Cnksr1 T A 4: 134,230,214 I465F possibly damaging Het
Coq10b A G 1: 55,052,984 D37G probably benign Het
Cpq T G 15: 33,213,104 Y90D possibly damaging Het
Depdc1a G A 3: 159,523,954 probably null Het
Eif2ak4 T A 2: 118,436,158 probably null Het
Eif3e C T 15: 43,252,304 M355I probably damaging Het
Eif4e1b G A 13: 54,786,944 V181M probably damaging Het
Erap1 A G 13: 74,646,561 E113G probably damaging Het
Fads2 A G 19: 10,064,285 L438P probably damaging Het
Fbl T A 7: 28,175,050 V67E probably damaging Het
Gde1 A G 7: 118,705,406 L82P probably damaging Het
Gm10226 T C 17: 21,691,977 S40P possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm1988 T A 7: 39,173,780 noncoding transcript Het
Gm6728 T C 6: 136,486,504 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Jag1 T A 2: 137,085,094 Q915L possibly damaging Het
Kdm5d G A Y: 941,645 G1282D probably benign Het
Krt83 A T 15: 101,486,994 L407Q probably damaging Het
Mlf1 A T 3: 67,393,963 H118L probably damaging Het
Mmp10 G T 9: 7,505,602 C289F probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myo9a T A 9: 59,900,449 S2029T probably damaging Het
Nap1l4 A C 7: 143,534,298 S174R probably damaging Het
Nos3 A G 5: 24,371,944 T490A probably benign Het
Olfr1000 A T 2: 85,608,374 C179S probably damaging Het
Olfr102 T A 17: 37,314,256 I43F probably damaging Het
Olfr1459 G A 19: 13,146,501 L53F probably damaging Het
Olfr76 A G 19: 12,120,436 V80A possibly damaging Het
Pdlim7 G C 13: 55,506,162 T214S probably benign Het
Piezo2 T C 18: 63,064,731 E1578G probably damaging Het
Ptcd1 T A 5: 145,147,905 probably benign Het
Sart3 C T 5: 113,759,216 probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn2 A G 11: 97,033,127 D279G possibly damaging Het
Sh2d3c A G 2: 32,745,902 D94G probably damaging Het
Slc12a4 A T 8: 105,951,634 V309E probably damaging Het
Slc1a6 A G 10: 78,787,803 E12G probably damaging Het
Smarcal1 T C 1: 72,595,976 probably null Het
Smr3a T C 5: 88,008,038 probably benign Het
Stox2 A G 8: 47,203,225 I72T probably damaging Het
Tmem234 G T 4: 129,600,707 probably benign Het
Tmem35b A G 4: 127,124,473 Q20R possibly damaging Het
Tom1l2 G A 11: 60,241,808 H430Y probably benign Het
Tpo T C 12: 30,103,290 Y355C probably damaging Het
Tulp2 A G 7: 45,516,651 N122S possibly damaging Het
Washc2 T A 6: 116,259,150 L1194H probably damaging Het
Xbp1 T C 11: 5,521,910 V12A probably benign Het
Other mutations in Olfr1277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Olfr1277 APN 2 111269912 missense probably damaging 1.00
IGL02550:Olfr1277 APN 2 111270004 missense probably damaging 0.99
IGL02661:Olfr1277 APN 2 111269466 missense possibly damaging 0.56
IGL02940:Olfr1277 APN 2 111269728 missense probably damaging 0.99
R0121:Olfr1277 UTSW 2 111270314 missense probably benign 0.01
R0402:Olfr1277 UTSW 2 111269863 missense probably damaging 1.00
R0903:Olfr1277 UTSW 2 111270356 missense probably benign
R1804:Olfr1277 UTSW 2 111269930 missense probably benign
R1806:Olfr1277 UTSW 2 111270277 missense possibly damaging 0.65
R1965:Olfr1277 UTSW 2 111269593 missense probably damaging 1.00
R3718:Olfr1277 UTSW 2 111270226 missense probably benign
R4044:Olfr1277 UTSW 2 111269582 missense probably benign 0.01
R4401:Olfr1277 UTSW 2 111269833 missense probably damaging 1.00
R4518:Olfr1277 UTSW 2 111269918 missense probably benign
R5309:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5312:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5727:Olfr1277 UTSW 2 111269852 nonsense probably null
R5772:Olfr1277 UTSW 2 111269712 nonsense probably null
R5827:Olfr1277 UTSW 2 111269921 missense probably damaging 1.00
R5882:Olfr1277 UTSW 2 111270139 missense probably damaging 0.99
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6728:Olfr1277 UTSW 2 111269673 missense probably benign 0.00
R7629:Olfr1277 UTSW 2 111269876 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCTTTGGATGCCCCATC -3'
(R):5'- AAAGACGATCTCTTTTGGAGGG -3'

Sequencing Primer
(F):5'- GATGCCCCATCCTTAGAGTGAAG -3'
(R):5'- CATGTGTCAGATTTTCTTTGGACAC -3'
Posted On2016-09-06