Incidental Mutation 'R5367:Arap1'
ID429412
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
SynonymsCentd2, 2410002L19Rik
MMRRC Submission 042945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5367 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101348067-101412586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101409130 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 721 (V721M)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010]
Predicted Effect probably benign
Transcript: ENSMUST00000084894
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084895
AA Change: V1106M

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: V1106M

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
PH 82 175 2.62e-17 SMART
PH 195 285 3.6e-6 SMART
ArfGap 289 415 2.4e-22 SMART
PH 498 606 1.23e-13 SMART
PH 616 710 1.08e0 SMART
RhoGAP 722 904 1.35e-63 SMART
Pfam:RA 926 1015 1.5e-10 PFAM
PH 1029 1141 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084896
AA Change: V1365M

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: V1365M

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098243
AA Change: V640M

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812
AA Change: V640M

DomainStartEndE-ValueType
PH 32 140 1.23e-13 SMART
PH 150 244 1.08e0 SMART
RhoGAP 256 438 1.35e-63 SMART
Pfam:RA 460 549 1.2e-11 PFAM
PH 563 675 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107010
AA Change: V1354M

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: V1354M

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125284
Predicted Effect probably damaging
Transcript: ENSMUST00000154239
AA Change: V721M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210162
Meta Mutation Damage Score 0.1818 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 60,039,636 Y252H probably damaging Het
Aadat T C 8: 60,526,596 I164T probably damaging Het
Adam11 A G 11: 102,773,653 H389R probably benign Het
Alkbh5 G T 11: 60,538,703 R94L possibly damaging Het
Ampd3 A G 7: 110,807,871 K644R possibly damaging Het
Ankhd1 T A 18: 36,589,408 L328H probably damaging Het
Ankrd55 G T 13: 112,318,502 V45F probably damaging Het
Apol7c C A 15: 77,526,147 V200F probably damaging Het
Arhgef40 A G 14: 51,989,699 D400G probably damaging Het
Bmp4 G T 14: 46,384,493 T198K possibly damaging Het
Cblb T A 16: 52,204,653 F970L probably damaging Het
Celf5 A G 10: 81,467,264 S148P probably damaging Het
Ckap5 T A 2: 91,615,141 C1708S possibly damaging Het
Clec2l T C 6: 38,677,524 F147L possibly damaging Het
Cnksr1 T A 4: 134,230,214 I465F possibly damaging Het
Coq10b A G 1: 55,052,984 D37G probably benign Het
Cpq T G 15: 33,213,104 Y90D possibly damaging Het
Depdc1a G A 3: 159,523,954 probably null Het
Eif2ak4 T A 2: 118,436,158 probably null Het
Eif3e C T 15: 43,252,304 M355I probably damaging Het
Eif4e1b G A 13: 54,786,944 V181M probably damaging Het
Erap1 A G 13: 74,646,561 E113G probably damaging Het
Fads2 A G 19: 10,064,285 L438P probably damaging Het
Fbl T A 7: 28,175,050 V67E probably damaging Het
Gde1 A G 7: 118,705,406 L82P probably damaging Het
Gm10226 T C 17: 21,691,977 S40P possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm1988 T A 7: 39,173,780 noncoding transcript Het
Gm6728 T C 6: 136,486,504 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Jag1 T A 2: 137,085,094 Q915L possibly damaging Het
Kdm5d G A Y: 941,645 G1282D probably benign Het
Krt83 A T 15: 101,486,994 L407Q probably damaging Het
Mlf1 A T 3: 67,393,963 H118L probably damaging Het
Mmp10 G T 9: 7,505,602 C289F probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myo9a T A 9: 59,900,449 S2029T probably damaging Het
Nap1l4 A C 7: 143,534,298 S174R probably damaging Het
Nos3 A G 5: 24,371,944 T490A probably benign Het
Olfr1000 A T 2: 85,608,374 C179S probably damaging Het
Olfr102 T A 17: 37,314,256 I43F probably damaging Het
Olfr1277 T A 2: 111,269,890 Q159L possibly damaging Het
Olfr1459 G A 19: 13,146,501 L53F probably damaging Het
Olfr76 A G 19: 12,120,436 V80A possibly damaging Het
Pdlim7 G C 13: 55,506,162 T214S probably benign Het
Piezo2 T C 18: 63,064,731 E1578G probably damaging Het
Ptcd1 T A 5: 145,147,905 probably benign Het
Sart3 C T 5: 113,759,216 probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn2 A G 11: 97,033,127 D279G possibly damaging Het
Sh2d3c A G 2: 32,745,902 D94G probably damaging Het
Slc12a4 A T 8: 105,951,634 V309E probably damaging Het
Slc1a6 A G 10: 78,787,803 E12G probably damaging Het
Smarcal1 T C 1: 72,595,976 probably null Het
Smr3a T C 5: 88,008,038 probably benign Het
Stox2 A G 8: 47,203,225 I72T probably damaging Het
Tmem234 G T 4: 129,600,707 probably benign Het
Tmem35b A G 4: 127,124,473 Q20R possibly damaging Het
Tom1l2 G A 11: 60,241,808 H430Y probably benign Het
Tpo T C 12: 30,103,290 Y355C probably damaging Het
Tulp2 A G 7: 45,516,651 N122S possibly damaging Het
Washc2 T A 6: 116,259,150 L1194H probably damaging Het
Xbp1 T C 11: 5,521,910 V12A probably benign Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101388049 missense probably damaging 0.96
IGL01311:Arap1 APN 7 101388136 nonsense probably null
IGL01349:Arap1 APN 7 101387152 missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101400605 critical splice donor site probably null
IGL01869:Arap1 APN 7 101400283 missense probably damaging 1.00
IGL02156:Arap1 APN 7 101388730 unclassified probably benign
IGL02320:Arap1 APN 7 101385029 missense probably benign
IGL02478:Arap1 APN 7 101400125 splice site probably null
R0133:Arap1 UTSW 7 101386229 missense probably damaging 0.98
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101390222 missense probably damaging 0.98
R0616:Arap1 UTSW 7 101401650 missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101400412 missense probably damaging 1.00
R0962:Arap1 UTSW 7 101384914 missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101404269 splice site probably benign
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1724:Arap1 UTSW 7 101400526 missense possibly damaging 0.91
R1793:Arap1 UTSW 7 101388622 missense probably benign
R1959:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R1960:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R2020:Arap1 UTSW 7 101401518 missense probably benign 0.00
R2128:Arap1 UTSW 7 101409320 missense probably damaging 1.00
R3737:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101390165 nonsense probably null
R4034:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R4386:Arap1 UTSW 7 101385571 missense probably benign
R4435:Arap1 UTSW 7 101390254 missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101404367 missense probably damaging 1.00
R4786:Arap1 UTSW 7 101385005 missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101398791 missense probably damaging 1.00
R4942:Arap1 UTSW 7 101401802 missense possibly damaging 0.95
R5253:Arap1 UTSW 7 101388644 missense probably benign 0.00
R5342:Arap1 UTSW 7 101404960 missense probably benign 0.00
R5397:Arap1 UTSW 7 101384912 missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101394738 missense probably damaging 1.00
R6052:Arap1 UTSW 7 101404033 missense probably damaging 1.00
R6574:Arap1 UTSW 7 101404001 missense probably damaging 1.00
R6645:Arap1 UTSW 7 101408111 missense possibly damaging 0.57
R7060:Arap1 UTSW 7 101409357 splice site probably null
R7191:Arap1 UTSW 7 101384992 missense probably benign 0.31
R7323:Arap1 UTSW 7 101400211 missense probably damaging 1.00
R7349:Arap1 UTSW 7 101390228 missense possibly damaging 0.95
R7516:Arap1 UTSW 7 101409331 missense probably benign 0.00
R8034:Arap1 UTSW 7 101394773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTCAGGCAATGCTAGACAC -3'
(R):5'- TCGAAGTTCCATCTGCGTGTC -3'

Sequencing Primer
(F):5'- GGCAATGCTAGACACACGTAC -3'
(R):5'- TGTCACAGCAGAGGTACCTG -3'
Posted On2016-09-06