Incidental Mutation 'R5367:Aadat'
ID429416
Institutional Source Beutler Lab
Gene Symbol Aadat
Ensembl Gene ENSMUSG00000057228
Gene Nameaminoadipate aminotransferase
SynonymsKATII, Kat2, mKat-2
MMRRC Submission 042945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5367 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60505932-60545677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60526596 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 164 (I164T)
Ref Sequence ENSEMBL: ENSMUSP00000148060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079472] [ENSMUST00000209338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079472
AA Change: I157T

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078436
Gene: ENSMUSG00000057228
AA Change: I157T

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 417 2.6e-22 PFAM
Pfam:Aminotran_MocR 124 424 7.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209338
AA Change: I164T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.3278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are viable and display earlier eye opening and development of air righting and open field crossing responses, and transient hyperactivity and neuronal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 60,039,636 Y252H probably damaging Het
Adam11 A G 11: 102,773,653 H389R probably benign Het
Alkbh5 G T 11: 60,538,703 R94L possibly damaging Het
Ampd3 A G 7: 110,807,871 K644R possibly damaging Het
Ankhd1 T A 18: 36,589,408 L328H probably damaging Het
Ankrd55 G T 13: 112,318,502 V45F probably damaging Het
Apol7c C A 15: 77,526,147 V200F probably damaging Het
Arap1 G A 7: 101,409,130 V721M probably damaging Het
Arhgef40 A G 14: 51,989,699 D400G probably damaging Het
Bmp4 G T 14: 46,384,493 T198K possibly damaging Het
Cblb T A 16: 52,204,653 F970L probably damaging Het
Celf5 A G 10: 81,467,264 S148P probably damaging Het
Ckap5 T A 2: 91,615,141 C1708S possibly damaging Het
Clec2l T C 6: 38,677,524 F147L possibly damaging Het
Cnksr1 T A 4: 134,230,214 I465F possibly damaging Het
Coq10b A G 1: 55,052,984 D37G probably benign Het
Cpq T G 15: 33,213,104 Y90D possibly damaging Het
Depdc1a G A 3: 159,523,954 probably null Het
Eif2ak4 T A 2: 118,436,158 probably null Het
Eif3e C T 15: 43,252,304 M355I probably damaging Het
Eif4e1b G A 13: 54,786,944 V181M probably damaging Het
Erap1 A G 13: 74,646,561 E113G probably damaging Het
Fads2 A G 19: 10,064,285 L438P probably damaging Het
Fbl T A 7: 28,175,050 V67E probably damaging Het
Gde1 A G 7: 118,705,406 L82P probably damaging Het
Gm10226 T C 17: 21,691,977 S40P possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm1988 T A 7: 39,173,780 noncoding transcript Het
Gm6728 T C 6: 136,486,504 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Jag1 T A 2: 137,085,094 Q915L possibly damaging Het
Kdm5d G A Y: 941,645 G1282D probably benign Het
Krt83 A T 15: 101,486,994 L407Q probably damaging Het
Mlf1 A T 3: 67,393,963 H118L probably damaging Het
Mmp10 G T 9: 7,505,602 C289F probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myo9a T A 9: 59,900,449 S2029T probably damaging Het
Nap1l4 A C 7: 143,534,298 S174R probably damaging Het
Nos3 A G 5: 24,371,944 T490A probably benign Het
Olfr1000 A T 2: 85,608,374 C179S probably damaging Het
Olfr102 T A 17: 37,314,256 I43F probably damaging Het
Olfr1277 T A 2: 111,269,890 Q159L possibly damaging Het
Olfr1459 G A 19: 13,146,501 L53F probably damaging Het
Olfr76 A G 19: 12,120,436 V80A possibly damaging Het
Pdlim7 G C 13: 55,506,162 T214S probably benign Het
Piezo2 T C 18: 63,064,731 E1578G probably damaging Het
Ptcd1 T A 5: 145,147,905 probably benign Het
Sart3 C T 5: 113,759,216 probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn2 A G 11: 97,033,127 D279G possibly damaging Het
Sh2d3c A G 2: 32,745,902 D94G probably damaging Het
Slc12a4 A T 8: 105,951,634 V309E probably damaging Het
Slc1a6 A G 10: 78,787,803 E12G probably damaging Het
Smarcal1 T C 1: 72,595,976 probably null Het
Smr3a T C 5: 88,008,038 probably benign Het
Stox2 A G 8: 47,203,225 I72T probably damaging Het
Tmem234 G T 4: 129,600,707 probably benign Het
Tmem35b A G 4: 127,124,473 Q20R possibly damaging Het
Tom1l2 G A 11: 60,241,808 H430Y probably benign Het
Tpo T C 12: 30,103,290 Y355C probably damaging Het
Tulp2 A G 7: 45,516,651 N122S possibly damaging Het
Washc2 T A 6: 116,259,150 L1194H probably damaging Het
Xbp1 T C 11: 5,521,910 V12A probably benign Het
Other mutations in Aadat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Aadat APN 8 60535758 missense probably benign 0.11
IGL01123:Aadat APN 8 60526614 missense probably benign 0.14
IGL01524:Aadat APN 8 60516072 missense probably damaging 0.97
IGL01767:Aadat APN 8 60507092 missense probably damaging 0.96
IGL02824:Aadat APN 8 60516022 missense probably benign 0.01
IGL03150:Aadat APN 8 60543562 missense probably damaging 0.97
IGL03356:Aadat APN 8 60531691 missense probably damaging 1.00
R0015:Aadat UTSW 8 60534571 splice site probably benign
R0294:Aadat UTSW 8 60534608 missense possibly damaging 0.77
R0533:Aadat UTSW 8 60531763 splice site probably benign
R0631:Aadat UTSW 8 60529445 splice site probably benign
R1585:Aadat UTSW 8 60526680 missense possibly damaging 0.67
R1728:Aadat UTSW 8 60526712 missense probably damaging 1.00
R1729:Aadat UTSW 8 60526712 missense probably damaging 1.00
R2051:Aadat UTSW 8 60507139 missense probably benign 0.00
R2362:Aadat UTSW 8 60532298 splice site probably benign
R3971:Aadat UTSW 8 60518581 missense probably damaging 1.00
R4126:Aadat UTSW 8 60531669 missense probably benign 0.00
R4736:Aadat UTSW 8 60540106 missense probably benign 0.30
R4739:Aadat UTSW 8 60540106 missense probably benign 0.30
R4750:Aadat UTSW 8 60526600 missense probably benign 0.10
R4874:Aadat UTSW 8 60516113 critical splice donor site probably null
R4884:Aadat UTSW 8 60526629 missense probably damaging 1.00
R5233:Aadat UTSW 8 60526622 missense probably benign 0.01
R6920:Aadat UTSW 8 60529433 missense probably damaging 0.97
R7064:Aadat UTSW 8 60531712 missense probably damaging 1.00
R7194:Aadat UTSW 8 60526622 missense probably benign 0.01
R7316:Aadat UTSW 8 60526634 missense probably damaging 0.98
R7634:Aadat UTSW 8 60516068 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TACAGCTCACTCTTCCAAAGTACTTG -3'
(R):5'- AGAACACATTCTGGTCACCCTC -3'

Sequencing Primer
(F):5'- GTTTACATGTTTAAGGGCATGAGCAG -3'
(R):5'- ATAGATTTCCTTCTTGCGGTCAC -3'
Posted On2016-09-06