Incidental Mutation 'R5368:Olfr1118'
ID429457
Institutional Source Beutler Lab
Gene Symbol Olfr1118
Ensembl Gene ENSMUSG00000083706
Gene Nameolfactory receptor 1118
SynonymsMOR264-22, Olfr1118-ps, GA_x6K02T2Q125-48795705-48796673
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5368 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87307581-87313621 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 87308782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090717] [ENSMUST00000090717] [ENSMUST00000121296] [ENSMUST00000216396]
Predicted Effect probably null
Transcript: ENSMUST00000090717
SMART Domains Protein: ENSMUSP00000132837
Gene: ENSMUSG00000070855

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.1e-53 PFAM
Pfam:7tm_1 32 281 1.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090717
SMART Domains Protein: ENSMUSP00000132837
Gene: ENSMUSG00000070855

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.1e-53 PFAM
Pfam:7tm_1 32 281 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120328
Predicted Effect probably benign
Transcript: ENSMUST00000121296
SMART Domains Protein: ENSMUSP00000144143
Gene: ENSMUSG00000083706

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.2e-51 PFAM
Pfam:7tm_1 32 281 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216396
AA Change: S18T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Olfr1118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1118 APN 2 87309581 missense possibly damaging 0.95
IGL01458:Olfr1118 APN 2 87309482 missense probably damaging 1.00
IGL02544:Olfr1118 APN 2 87309127 missense possibly damaging 0.91
IGL02748:Olfr1118 APN 2 87309665 missense probably damaging 1.00
IGL03077:Olfr1118 APN 2 87309712 makesense probably null
R0411:Olfr1118 UTSW 2 87309058 missense probably benign 0.07
R0525:Olfr1118 UTSW 2 87309349 missense probably benign 0.10
R1703:Olfr1118 UTSW 2 87309410 missense probably benign 0.00
R1750:Olfr1118 UTSW 2 87308852 missense probably benign 0.02
R2005:Olfr1118 UTSW 2 87309448 missense probably benign 0.24
R2090:Olfr1118 UTSW 2 87309418 missense probably benign 0.02
R3846:Olfr1118 UTSW 2 87309182 missense probably benign 0.15
R4011:Olfr1118 UTSW 2 87309211 missense probably benign 0.03
R4077:Olfr1118 UTSW 2 87308864 unclassified probably null 0.42
R5132:Olfr1118 UTSW 2 87308938 missense probably damaging 1.00
R7355:Olfr1118 UTSW 2 87309410 missense probably benign 0.00
R7405:Olfr1118 UTSW 2 87308995 missense probably benign 0.00
R7437:Olfr1118 UTSW 2 87309343 missense probably benign
R7554:Olfr1118 UTSW 2 87309005 missense probably damaging 1.00
R7609:Olfr1118 UTSW 2 87309509 missense probably benign 0.01
R8156:Olfr1118 UTSW 2 87308974 missense probably damaging 0.97
RF010:Olfr1118 UTSW 2 87308840 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGTCAACTCTTCAAAGAATCTGAG -3'
(R):5'- GCATTCTTGGAATAGTAGCTGTTAC -3'

Sequencing Primer
(F):5'- AGAATCTGAGTTAAACAAATGGGAAC -3'
(R):5'- AGAGCAGGGTCAGTTTTTG -3'
Posted On2016-09-06