Incidental Mutation 'R5368:D430041D05Rik'
ID 429459
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene Name RIKEN cDNA D430041D05 gene
Synonyms G2
MMRRC Submission 043204-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # R5368 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103973418-104241358 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104078629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1229 (V1229A)
Ref Sequence ENSEMBL: ENSMUSP00000155485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]
AlphaFold A0A2R8VKG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000089726
AA Change: V545A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: V545A

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136156
AA Change: V545A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000141159
AA Change: V430A

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: V430A

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149165
Predicted Effect probably damaging
Transcript: ENSMUST00000230671
AA Change: V1229A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 130,740,925 (GRCm39) H97L possibly damaging Het
Abca9 T A 11: 110,036,372 (GRCm39) N579I probably damaging Het
Acbd3 A T 1: 180,549,660 (GRCm39) probably benign Het
Ankrd50 A T 3: 38,509,199 (GRCm39) I1056N probably damaging Het
Ceacam18 T C 7: 43,291,458 (GRCm39) V300A probably benign Het
Cfap46 C A 7: 139,207,389 (GRCm39) R1843S possibly damaging Het
Dbx2 G A 15: 95,538,522 (GRCm39) S206L probably benign Het
Dnah11 A T 12: 117,918,628 (GRCm39) D1530E probably damaging Het
Ecm2 A C 13: 49,674,419 (GRCm39) T280P probably benign Het
Emc2 G A 15: 43,375,207 (GRCm39) probably null Het
Epb42 C T 2: 120,849,943 (GRCm39) V689I probably benign Het
Fam114a1 T A 5: 65,163,452 (GRCm39) M209K possibly damaging Het
Fam117a C T 11: 95,266,459 (GRCm39) S193F probably damaging Het
Foxp2 A T 6: 15,377,913 (GRCm39) probably benign Het
Frmd6 T A 12: 70,910,874 (GRCm39) C19* probably null Het
Fyb1 A G 15: 6,610,159 (GRCm39) probably null Het
Gata6 C A 18: 11,063,059 (GRCm39) H442Q possibly damaging Het
Gldc A G 19: 30,135,921 (GRCm39) S160P probably benign Het
Gm3952 A G 8: 129,472,455 (GRCm39) S1626P possibly damaging Het
Gm9762 T A 3: 78,873,742 (GRCm39) noncoding transcript Het
Gtpbp2 T C 17: 46,477,230 (GRCm39) probably benign Het
Hgd A T 16: 37,410,113 (GRCm39) T50S probably benign Het
Itpr1 C T 6: 108,364,459 (GRCm39) T22M probably damaging Het
Kif26b G A 1: 178,743,449 (GRCm39) E1182K probably damaging Het
Kirrel3 A G 9: 34,919,034 (GRCm39) E230G probably damaging Het
Leng8 A G 7: 4,142,987 (GRCm39) Y88C probably damaging Het
Lpo T C 11: 87,711,895 (GRCm39) D54G possibly damaging Het
Lypd2 G T 15: 74,604,908 (GRCm39) A29E probably benign Het
Mdn1 C T 4: 32,723,690 (GRCm39) P2542L probably damaging Het
Mical3 T C 6: 120,936,434 (GRCm39) Y1364C probably damaging Het
Mroh2b A G 15: 4,935,054 (GRCm39) N163S probably damaging Het
Mtf1 G A 4: 124,718,872 (GRCm39) C295Y probably damaging Het
Nbn T A 4: 15,969,391 (GRCm39) L212Q probably damaging Het
Obscn A T 11: 58,959,852 (GRCm39) probably null Het
Or10ag56 T A 2: 87,139,126 (GRCm39) probably null Het
Or4c110 A G 2: 88,832,435 (GRCm39) S66P probably damaging Het
Peli1 A G 11: 21,098,389 (GRCm39) T375A probably damaging Het
Picalm T C 7: 89,856,803 (GRCm39) *611Q probably null Het
Plch1 G T 3: 63,609,394 (GRCm39) Q938K possibly damaging Het
Plxnb2 A G 15: 89,043,796 (GRCm39) V1352A possibly damaging Het
Pmepa1 G A 2: 173,070,115 (GRCm39) R147W probably damaging Het
Prdm16 T G 4: 154,429,848 (GRCm39) K373Q probably damaging Het
Qki T G 17: 10,457,964 (GRCm39) E135A probably damaging Het
Rad50 T C 11: 53,575,073 (GRCm39) K556E probably benign Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Sin3a T A 9: 57,018,084 (GRCm39) D834E possibly damaging Het
Smg8 G A 11: 86,971,086 (GRCm39) S895L probably benign Het
Sorl1 T C 9: 41,890,686 (GRCm39) I1944M probably benign Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Tmprss7 A T 16: 45,481,252 (GRCm39) W645R probably damaging Het
Tns1 T C 1: 73,980,176 (GRCm39) M1111V probably benign Het
Ttn A C 2: 76,608,726 (GRCm39) D17763E probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubr4 G A 4: 139,124,839 (GRCm39) probably benign Het
Usp31 T C 7: 121,260,588 (GRCm39) H637R probably damaging Het
Vps50 A C 6: 3,567,739 (GRCm39) E545A possibly damaging Het
Wdfy3 G T 5: 102,020,724 (GRCm39) L2527M probably damaging Het
Wfdc2 T C 2: 164,405,354 (GRCm39) V85A possibly damaging Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104,031,648 (GRCm39) missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104,088,511 (GRCm39) nonsense probably null
IGL01669:D430041D05Rik APN 2 104,085,306 (GRCm39) missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104,060,749 (GRCm39) missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104,038,559 (GRCm39) splice site probably benign
IGL02268:D430041D05Rik APN 2 104,071,500 (GRCm39) missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104,085,351 (GRCm39) missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104,079,690 (GRCm39) missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104,060,631 (GRCm39) missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104,078,611 (GRCm39) missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104,060,650 (GRCm39) missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104,044,604 (GRCm39) missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104,071,508 (GRCm39) missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104,051,556 (GRCm39) missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104,078,719 (GRCm39) missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104,085,389 (GRCm39) missense probably benign
R0064:D430041D05Rik UTSW 2 104,079,502 (GRCm39) missense probably damaging 1.00
R0135:D430041D05Rik UTSW 2 104,085,379 (GRCm39) missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104,035,545 (GRCm39) missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104,031,589 (GRCm39) missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104,085,685 (GRCm39) missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 103,998,509 (GRCm39) missense probably damaging 0.99
R0436:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0441:D430041D05Rik UTSW 2 103,998,292 (GRCm39) missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104,063,790 (GRCm39) missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104,063,790 (GRCm39) missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104,060,651 (GRCm39) missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104,060,773 (GRCm39) missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104,079,690 (GRCm39) missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104,088,674 (GRCm39) missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104,031,648 (GRCm39) missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 103,985,363 (GRCm39) missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104,038,428 (GRCm39) missense probably damaging 1.00
R1574:D430041D05Rik UTSW 2 104,051,553 (GRCm39) small deletion probably benign
R1604:D430041D05Rik UTSW 2 104,035,487 (GRCm39) missense probably damaging 1.00
R1605:D430041D05Rik UTSW 2 104,085,915 (GRCm39) missense possibly damaging 0.46
R1623:D430041D05Rik UTSW 2 103,983,308 (GRCm39) missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104,051,556 (GRCm39) missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 103,998,446 (GRCm39) missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104,060,800 (GRCm39) missense probably benign 0.39
R2080:D430041D05Rik UTSW 2 103,987,161 (GRCm39) missense probably damaging 1.00
R2101:D430041D05Rik UTSW 2 103,979,175 (GRCm39) missense probably damaging 1.00
R2240:D430041D05Rik UTSW 2 103,987,161 (GRCm39) missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104,085,660 (GRCm39) missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104,085,403 (GRCm39) missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104,044,522 (GRCm39) missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104,044,522 (GRCm39) missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104,044,522 (GRCm39) missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104,087,713 (GRCm39) missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104,086,684 (GRCm39) missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104,022,778 (GRCm39) critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104,063,824 (GRCm39) missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104,038,528 (GRCm39) missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104,038,528 (GRCm39) missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104,088,788 (GRCm39) missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104,044,441 (GRCm39) missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104,031,455 (GRCm39) critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104,085,754 (GRCm39) missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104,085,732 (GRCm39) missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104,088,847 (GRCm39) missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104,086,945 (GRCm39) missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104,085,754 (GRCm39) missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104,078,630 (GRCm39) missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 103,998,412 (GRCm39) missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104,086,637 (GRCm39) missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 103,998,548 (GRCm39) splice site probably null
R6804:D430041D05Rik UTSW 2 103,979,371 (GRCm39) missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104,031,604 (GRCm39) missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104,071,500 (GRCm39) missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104,022,883 (GRCm39) missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104,088,698 (GRCm39) missense probably benign 0.06
R7250:D430041D05Rik UTSW 2 104,086,961 (GRCm39) missense possibly damaging 0.92
R7251:D430041D05Rik UTSW 2 104,051,511 (GRCm39) missense probably damaging 1.00
R7313:D430041D05Rik UTSW 2 104,085,910 (GRCm39) missense probably benign
R7359:D430041D05Rik UTSW 2 104,044,482 (GRCm39) missense probably damaging 1.00
R7361:D430041D05Rik UTSW 2 104,085,363 (GRCm39) missense possibly damaging 0.46
R7436:D430041D05Rik UTSW 2 104,087,447 (GRCm39) missense probably benign 0.02
R7472:D430041D05Rik UTSW 2 104,240,484 (GRCm39) missense unknown
R7492:D430041D05Rik UTSW 2 104,031,650 (GRCm39) missense probably damaging 1.00
R7631:D430041D05Rik UTSW 2 103,979,363 (GRCm39) nonsense probably null
R7672:D430041D05Rik UTSW 2 104,071,581 (GRCm39) missense probably benign 0.01
R7721:D430041D05Rik UTSW 2 104,088,874 (GRCm39) missense probably benign 0.00
R7754:D430041D05Rik UTSW 2 104,087,504 (GRCm39) missense probably benign 0.01
R7882:D430041D05Rik UTSW 2 104,087,974 (GRCm39) nonsense probably null
R7896:D430041D05Rik UTSW 2 104,088,385 (GRCm39) missense probably benign 0.05
R7986:D430041D05Rik UTSW 2 104,087,096 (GRCm39) missense probably damaging 1.00
R8005:D430041D05Rik UTSW 2 104,088,599 (GRCm39) missense possibly damaging 0.72
R8016:D430041D05Rik UTSW 2 104,022,864 (GRCm39) missense probably damaging 1.00
R8054:D430041D05Rik UTSW 2 103,985,390 (GRCm39) missense possibly damaging 0.93
R8058:D430041D05Rik UTSW 2 103,979,128 (GRCm39) makesense probably null
R8100:D430041D05Rik UTSW 2 104,087,287 (GRCm39) missense probably benign 0.00
R8461:D430041D05Rik UTSW 2 103,998,280 (GRCm39) missense possibly damaging 0.46
R8695:D430041D05Rik UTSW 2 104,085,299 (GRCm39) critical splice donor site probably null
R8885:D430041D05Rik UTSW 2 104,071,538 (GRCm39) missense probably damaging 1.00
R9007:D430041D05Rik UTSW 2 104,087,930 (GRCm39) missense probably benign 0.08
R9009:D430041D05Rik UTSW 2 104,240,521 (GRCm39) start gained probably benign
R9335:D430041D05Rik UTSW 2 104,078,674 (GRCm39) missense probably damaging 1.00
R9348:D430041D05Rik UTSW 2 104,088,337 (GRCm39) missense probably benign 0.05
R9384:D430041D05Rik UTSW 2 104,087,920 (GRCm39) missense probably benign
R9483:D430041D05Rik UTSW 2 104,087,563 (GRCm39) missense probably benign 0.44
R9489:D430041D05Rik UTSW 2 104,087,189 (GRCm39) missense probably benign 0.20
R9605:D430041D05Rik UTSW 2 104,087,189 (GRCm39) missense probably benign 0.20
R9613:D430041D05Rik UTSW 2 104,060,737 (GRCm39) missense probably benign 0.09
R9698:D430041D05Rik UTSW 2 103,985,396 (GRCm39) missense probably damaging 1.00
X0024:D430041D05Rik UTSW 2 104,022,911 (GRCm39) critical splice acceptor site probably null
Z1176:D430041D05Rik UTSW 2 104,087,201 (GRCm39) missense probably benign 0.00
Z1176:D430041D05Rik UTSW 2 103,985,280 (GRCm39) missense probably damaging 1.00
Z1177:D430041D05Rik UTSW 2 104,071,536 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATAGCCAGATCTGAGCCACC -3'
(R):5'- AGAGCCTTGGGTTCAACCATG -3'

Sequencing Primer
(F):5'- AGATCTGAGCCACCCTCGC -3'
(R):5'- CTGCAATAAATCATCTTAAGAGGCAC -3'
Posted On 2016-09-06